Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
The Antibody Registry is the authoritative source for antibody identifiers, which can be used in publications to uniquely mark the antibodies used in a paper.
http://antibodyregistry.org/AB_2687497
Comments: Flow cytometry
Host Organism: mouse
Clonality: monoclonal
Target(s): CD8
Proper citation: BD Biosciences Cat# 565310, RRID:AB_2687497 Copy
http://antibodyregistry.org/AB_2687614
Comments: Applications: W, IP, ChIP
Host Organism: rabbit
Clonality: monoclonal
Target(s): NF-κB1 p105/p50
Proper citation: Cell Signaling Technology Cat# 12540, RRID:AB_2687614 Copy
http://antibodyregistry.org/AB_2687428
Comments: "Next, we attempted to isolate bnAbs from cow #26. Peripheral blood mononuclear cells (PBMCs) from timepoints d70 and d238 were sorted with fluorophores conjugated to anti-cow IgG, and biotinylated BG505 SOSIP was used as antigen bait as described previously (Extended Data Fig. 4) 21. Sorting and screening of PBMCs at different timepoints (Extended Data Fig. 5) using different sort strategies (Extended Data Fig. 4) resulted in the isolation of 10 mAbs named NC-Cow1 to NC-Cow10. Sequences and alignments of the heavy and light chain sequences for NC-Cow1 to NC-Cow10 are listed in Supplementary Table 2. Interestingly, all 10 antibodies have ultralong HCDR3s (Fig. 3a)"
Heavy Chain Nucleotide: ATGGGATGGTCATGTATCATCCTTTTTCTAGTAGCAACTGCAACCGGTGTACATTCCCAGGTGCAGCTGCGGGAGTCGGGCCCCAGCCTGGTGAAGCCGTCACAGACCCTCTCCCTCACCTGCATGGTCTCTGGATTCTCATTGAACGACAAGGCTGTAGGCTGGGTCCGCCAGGCTCCAGGGAAGGCGCTGGAGTGGCTCGGTAGTATAGACGCTGGTGGAAGCACAGGCTATAACCCAGGCCTGAAATCCCGACTCAGCATCTCCAAGGACAACTCCAAGAACCAAGTCTCTCTGTCAGTGAGCAGCGTGACAACTGAGGACTCGGCCACATACTACTGTGGTACTGTGCACCAGAGGACACAGCCAAAACAAACTTGTCCTAATGGCTATAGTGATGATAGTGCTCTTCGTTATTACAGTAGATGTTCTGATCGTGATTGCTGGCGTTGTACTGGGACTACGTATTATGATACTTGTCAATGTAGTAGTTATACTTATATTCATACTTACGAATTATACGTCGATGCCTGGGGCCAAGGACTCCTGGTCACCGTCTCCTCA
Light Chain Nucleotide: ATGGGATGGTCATGTATCATCCTTTTTCTAGTAGCAACTGCAACCGGTGTACATCAGGCTGTGCTGACTCAGCCATCATCCGTGTCCGGGTCCCTGGGCCAGAGGGTCTCCATCACCTGCTCTGGAAGCAGCAGCAATGTTGGAAATGGATATGTGAGCTGGTACCAACTGATCCCAGGATCGGCCCCCAGAACCCTCATCTATGGTGACACCAGTCGAGCCTCGGGGGTCCCCGACCGATTCTCCGGCTCCAGGTCTGGGAACACAGCCACCCTGACCATCAGCTCGCTCCAGGCTGAAGACGAGGCAGATTATTTCTGTGCATCTCCTGAGGATAGTAGCAGTAATGCTGTTTTCGGCAGCGGGACCACACTGACCGTCCTG
Host Organism: cow
Clonality: monoclonal
Target(s): HCDR3
Proper citation: International AIDS Vaccine Initiative (IAVI) Cat# NC-Cow6, RRID:AB_2687428 Copy
http://antibodyregistry.org/AB_2687527
Comments: Flow cytometry
Host Organism: rat
Clonality: monoclonal
Target(s): F4/80
Proper citation: BD Biosciences Cat# 565410, RRID:AB_2687527 Copy
http://antibodyregistry.org/AB_2687560
Comments: Applications: Western Blot, Simple Western, Flow Cytometry, Immunohistochemistry, Immunocytochemistry/ Immunofluorescence, Immunohistochemistry-Paraffin, Immunohistochemistry-Frozen
Host Organism: Mouse
Clonality: monoclonal
Target(s): GFAP
Proper citation: Novus Cat# NBP2-33184AF405, RRID:AB_2687560 Copy
http://antibodyregistry.org/AB_2687466
Comments: Image validation for IHC-P, WB in MDS.
Host Organism: rabbit
Clonality: monoclonal
Target(s): VDAC1 / Porin
Proper citation: Abcam Cat# ab154856, RRID:AB_2687466 Copy
http://antibodyregistry.org/AB_2687514
Host Organism: mouse
Clonality: monoclonal
Target(s): Anti-Androgen Receptor
Proper citation: BioGenex Cat# AM256, RRID:AB_2687514 Copy
http://antibodyregistry.org/AB_2687656
Comments: Original Manufacturer: Dako. Now part of Agilent.
Host Organism: mouse
Clonality: monoclonal
Target(s): Granzyme B
Proper citation: Agilent Cat# M723501-2, RRID:AB_2687656 Copy
http://antibodyregistry.org/AB_2687554
Comments: Image validation available for WB in MDS.
Host Organism: rabbit
Clonality: monoclonal
Target(s): PCBP1
Proper citation: Abcam Cat# ab168378, RRID:AB_2687554 Copy
http://antibodyregistry.org/AB_2687491
Comments: Originating manufacturer of this product.
Applications: WB, ELISA
Host Organism: mouse
Clonality: monoclonal
Target(s): Alpha Tubulin
Proper citation: Proteintech Cat# HRP-66031, RRID:AB_2687491 Copy
http://antibodyregistry.org/AB_2687530
Comments: Applications: W, IP
Host Organism: rabbit
Clonality: monoclonal
Target(s): UCP1
Proper citation: Cell Signaling Technology Cat# 14670, RRID:AB_2687530 Copy
http://antibodyregistry.org/AB_2687434
Comments: Vendor recommended applications: WB, ELISA, IHC, FCM
Host Organism: mouse
Clonality: monoclonal
Target(s): Matrix protein 1 and 2
Proper citation: Kerafast Cat# EMS009, RRID:AB_2687434 Copy
http://antibodyregistry.org/AB_2687559
Comments: Applications: W, IHC-P
Host Organism: mouse
Clonality: monoclonal
Target(s): HSP70
Proper citation: Cell Signaling Technology Cat# 46477, RRID:AB_2687559 Copy
http://antibodyregistry.org/AB_2687517
Comments: Image validation for IHC-P, WB in MDS.
Host Organism: mouse
Clonality: monoclonal
Target(s): CamKII gamma
Proper citation: Abcam Cat# ab201966, RRID:AB_2687517 Copy
http://antibodyregistry.org/AB_2687677
Comments: "Monoclonal antibodies 7C9 and 8E8 were obtained, after intraperitoneal injection of BALB/c mice (Jackson Laboratories), using standard techniques" - PMID:11967265
Host Organism: mouse
Clonality: monoclonal
Target(s): Xenopus leaves adam13/33 cysteine rich domain
Proper citation: Dominique Alfandari - University of Massachusetts Amherst Cat# Alfandari-7, RRID:AB_2687677 Copy
http://antibodyregistry.org/AB_2687547
Comments: Intracellular staining (flow Cytotoxicityometry)
Host Organism: rat
Clonality: monoclonal
Target(s): Mouse IL-17A
Proper citation: BD Biosciences Cat# 563354, RRID:AB_2687547 Copy
http://antibodyregistry.org/AB_2687505
Comments: Applications: W, IP, IHC-P, IF-IC
Host Organism: rabbit
Clonality: monoclonal
Target(s): ACC
Proper citation: Cell Signaling Technology Cat# 11818, RRID:AB_2687505 Copy
http://antibodyregistry.org/AB_2687444
Comments: Image validation for WB, IHC-P, IF, Flow Cyt in MDS.
Host Organism: rat
Clonality: monoclonal
Target(s): Proteasome 26S S10
Proper citation: Abcam Cat# ab182576, RRID:AB_2687444 Copy
http://antibodyregistry.org/AB_2687212
Comments: Applications: FC
Host Organism: mouse
Clonality: monoclonal
Target(s): CD41
Proper citation: BioLegend Cat# 303735, RRID:AB_2687212 Copy
http://antibodyregistry.org/AB_2687226
Comments: Applications: FC
Host Organism: armenian hamster
Clonality: monoclonal
Target(s): CD16.2
Proper citation: BioLegend Cat# 149529, RRID:AB_2687226 Copy
Can't find your Antibody?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific antibody, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your antibody in the search results, please help us by registering it into the system — it's easy. Register it with The Antibody Registry (an Antibody Registry account is required. Create a free Antibody Registry account if you don't have one yet). An RRID will be generated in 1-2 business days.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.