Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

The Antibody Registry is the authoritative source for antibody identifiers, which can be used in publications to uniquely mark the antibodies used in a paper.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

On page 35 showing 681 ~ 700 out of 1,283,899 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to an Authentication Report or Collection
  • RRID:AB_2687426

http://antibodyregistry.org/AB_2687426

Comments: "Next, we attempted to isolate bnAbs from cow #26. Peripheral blood mononuclear cells (PBMCs) from timepoints d70 and d238 were sorted with fluorophores conjugated to anti-cow IgG, and biotinylated BG505 SOSIP was used as antigen bait as described previously (Extended Data Fig. 4) 21. Sorting and screening of PBMCs at different timepoints (Extended Data Fig. 5) using different sort strategies (Extended Data Fig. 4) resulted in the isolation of 10 mAbs named NC-Cow1 to NC-Cow10. Sequences and alignments of the heavy and light chain sequences for NC-Cow1 to NC-Cow10 are listed in Supplementary Table 2. Interestingly, all 10 antibodies have ultralong HCDR3s (Fig. 3a)"
Heavy Chain Nucleotide: ATGGGATGGTCATGTATCATCCTTTTTCTAGTAGCAACTGCAACCGGTGTACATTCCAAGGTGCAGCTGCGGGAGTCGGGCCCCAGCCTGGTGAAGCCGTCACAGACCCTCTCCCTCACCTGCATGGTCTCTGGATTCTCATTGAACGACGAGGCTGTAGGCTGGGTCCGCCAGGCTCCAGGGAAGGCGCTGGAGTGGCTCGGTAGTATAGACGCTGGTGGAAGCACAGGCTATAACCCAGGCCTGAAATCCCGACTCAGCATCTCCAAGGACAACTCCAAGAACCAAGTTTCTCTGTCAGTGAGCAGCGTGACAACTGAGGACTCGGCCACATACTACTGTGGTACTGTGCACCAGAGGACACAGCCAAAACAAACTTGTCCTAATGGCTATAGTGATGATAGTGCTCTTCGTTATTACAGTAGATGTTCTGATCGTGATTGTTGGCGTTGTACTGGGACTACGTATTATGATACTTGTCAATGTAGTAGTTATACTTATATTCATACTTACGAATTATACGTCGATGCCTGGGGCCAAGGACTCCTGGTCACCGTCTCCTCA
Light Chain Nucleotide: ATGGGATGGTCATGTATCATCCTTTTTCTAGTAGCAACTGCAACCGGTGTACATCAGGCTGTGCTGACTCAGCCATCATCCGTGTCCGGGTCCCTGGGCCAGAGGGTCTCCATCACCTGCTCTGGAAGCAGCAGCAATGTTGGAAATGGATATGTGAGCTGGTACCAACTGATCCCAGGATCGGCCCCCAGAACCCTCATCTATGGTGACACCAGTCGAGCCTCGGGGGTCCCCGACCGATTCTCCGGCTCCAGGTCTGGGAACACAGCCACCCTGACCATCAGCTCGCTCCAGGCTGAAGACGAGGCAGATTATTTCTGTGCATCTCCTGAGGATAGTAGCAGTAATGCTGTTTTCGGCAGCGGGACCACACTGACCGTCCTG
Host Organism: cow
Clonality: monoclonal
Target(s): HCDR3

Proper citation: International AIDS Vaccine Initiative (IAVI) Cat# NC-Cow4, RRID:AB_2687426 Copy   


  • RRID:AB_2687579

    This resource has 100+ mentions.

http://antibodyregistry.org/AB_2687579

Comments: Applications: W, IP, IHC-P, IF-IC, F
Host Organism: rabbit
Clonality: monoclonal
Target(s): LAMP1

Proper citation: Cell Signaling Technology Cat# 9091, RRID:AB_2687579 Copy   


  • RRID:AB_2687632

http://antibodyregistry.org/AB_2687632

Comments: Image validation available for WB in MDS.
Host Organism: mouse
Clonality: monoclonal
Target(s): Gata6

Proper citation: Abcam Cat# Ab175425, RRID:AB_2687632 Copy   


  • RRID:AB_2687528

    This resource has 1+ mentions.

http://antibodyregistry.org/AB_2687528

Host Organism: mouse
Clonality: monoclonal
Target(s): Ki-67

Proper citation: Agilent Cat# M724029, RRID:AB_2687528 Copy   


http://antibodyregistry.org/AB_2687509

Comments: Image validation for ICC/IF, WB in MDS.
Host Organism: rabbit
Clonality: monoclonal
Target(s): TGF beta induced factor 2

Proper citation: Abcam Cat# ab155948, RRID:AB_2687509 Copy   


  • RRID:AB_2687673

    This resource has 1+ mentions.

http://antibodyregistry.org/AB_2687673

Comments: Kedhgicar et al., in press, submitted life
Host Organism: mouse
Clonality: monoclonal
Target(s): Xenopus leaves rpn1

Proper citation: Dominique Alfandari - University of Massachusetts Amherst Cat# Alfandari-3, RRID:AB_2687673 Copy   


  • RRID:AB_2687510

    This resource has 1+ mentions.

Discontinued

Ratings or validation data are available for this resource

http://antibodyregistry.org/AB_2687510

Comments: Discontinued; Applications: remove
Info: Independent validation by the NYU Lagone was performed for: IHC. This antibody was found to have the following characteristics: Functional in human:TRUE, NonFunctional in human:FALSE, Functional in animal:FALSE, NonFunctional in animal:FALSE
Host Organism: mouse
Clonality: monoclonal
Target(s): FUT8

Proper citation: Proteintech Cat# 66118, RRID:AB_2687510 Copy   


  • RRID:AB_2687555

    This resource has 1+ mentions.

http://antibodyregistry.org/AB_2687555

Host Organism: mouse
Clonality: monoclonal
Target(s): hnRNP E1

Proper citation: Santa Cruz Biotechnology Cat# sc-393076, RRID:AB_2687555 Copy   


  • RRID:AB_2687616

    This resource has 100+ mentions.

Ratings or validation data are available for this resource

http://antibodyregistry.org/AB_2687616

Comments: Applications: W, IP, IHC-P, IF-IC
Info: Independent validation by the NYU Lagone was performed for: IHC. This antibody was found to have the following characteristics: Functional in human:TRUE, NonFunctional in human:FALSE, Functional in animal:FALSE, NonFunctional in animal:FALSE
Host Organism: rabbit
Clonality: monoclonal
Target(s): N-Cadherin

Proper citation: Cell Signaling Technology Cat# 13116, RRID:AB_2687616 Copy   


  • RRID:AB_2687488

    This resource has 1+ mentions.

http://antibodyregistry.org/AB_2687488

Comments: Flow cytometry
Host Organism: mouse
Clonality: monoclonal
Target(s): CD183

Proper citation: BD Biosciences Cat# 565223, RRID:AB_2687488 Copy   


  • RRID:AB_2687623

    This resource has 1+ mentions.

http://antibodyregistry.org/AB_2687623

Host Organism: mouse
Clonality: monoclonal
Target(s): CD28

Proper citation: Tonbo Biosciences Cat# 50-0289, RRID:AB_2687623 Copy   


  • RRID:AB_2687529

    This resource has 50+ mentions.

http://antibodyregistry.org/AB_2687529

Comments: Applications: W, IP, IF-IC, F
Host Organism: rabbit
Clonality: monoclonal
Target(s): iNOS

Proper citation: Cell Signaling Technology Cat# 13120, RRID:AB_2687529 Copy   


  • RRID:AB_2687474

    This resource has 50+ mentions.

Ratings or validation data are available for this resource

http://antibodyregistry.org/AB_2687474

Comments: Applications: W, IP
Info: Independent validation by the NYU Lagone was performed for: IHC. This antibody was found to have the following characteristics: Functional in human:FALSE, NonFunctional in human:FALSE, Functional in animal:FALSE, NonFunctional in animal:FALSE
Host Organism: rabbit
Clonality: monoclonal
Target(s): xCT/SLC7A11

Proper citation: Cell Signaling Technology Cat# 12691, RRID:AB_2687474 Copy   


  • RRID:AB_2687460

    This resource has 1+ mentions.

http://antibodyregistry.org/AB_2687460

Comments: Image validation for WB in MDS.
Host Organism: mouse
Clonality: monoclonal
Target(s): Ubiquitin

Proper citation: Boston Biochem Cat# A-104, RRID:AB_2687460 Copy   


  • RRID:AB_2687668

    This resource has 1+ mentions.

http://antibodyregistry.org/AB_2687668

Comments: Image validation available for WB, ICC/IF, Flow Cyt in MDS.
Host Organism: rabbit
Clonality: monoclonal
Target(s): Synthetic peptide within human snap29 aa 1-100

Proper citation: Abcam Cat# ab181151, RRID:AB_2687668 Copy   


http://antibodyregistry.org/AB_2687518

Comments: Applications: W
Host Organism: rabbit
Clonality: monoclonal
Target(s): Phospho-c-Myc (Ser62)

Proper citation: Cell Signaling Technology Cat# 13748, RRID:AB_2687518 Copy   


  • RRID:AB_2687503

    This resource has 10+ mentions.

http://antibodyregistry.org/AB_2687503

Comments: Image validation for ICC/IF, WB, IHC-P
Host Organism: rabbit
Clonality: monoclonal
Target(s): CPT2

Proper citation: Abcam Cat# ab181114, RRID:AB_2687503 Copy   


http://antibodyregistry.org/AB_2687545

Comments: Intracellular staining (flow Cytotoxicityometry)
Host Organism: mouse
Clonality: monoclonal
Target(s): Mouse RORγt

Proper citation: BD Biosciences Cat# 562894, RRID:AB_2687545 Copy   


  • RRID:AB_2687515

    This resource has 1+ mentions.

http://antibodyregistry.org/AB_2687515

Comments: Image validation for WB in MDS.
Host Organism: mouse
Clonality: monoclonal
Target(s): MLL2

Proper citation: Santa Cruz Biotechnology Cat# SC-293217, RRID:AB_2687515 Copy   


  • RRID:AB_2687441

    This resource has 1+ mentions.

http://antibodyregistry.org/AB_2687441

Comments: Image validation for WB, IP in MDS. Epitope mapping between amino acids 186-207
Host Organism: mouse
Clonality: monoclonal
Target(s): EDG-2

Proper citation: Santa Cruz Biotechnology Cat# sc-515665, RRID:AB_2687441 Copy   



Can't find your Antibody?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific antibody, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your antibody in the search results, please help us by registering it into the system — it's easy. Register it with The Antibody Registry (an Antibody Registry account is required. Create a free Antibody Registry account if you don't have one yet). An RRID will be generated in 1-2 business days.

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X