Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
The Antibody Registry is the authoritative source for antibody identifiers, which can be used in publications to uniquely mark the antibodies used in a paper.
http://antibodyregistry.org/AB_2687426
Comments: "Next, we attempted to isolate bnAbs from cow #26. Peripheral blood mononuclear cells (PBMCs) from timepoints d70 and d238 were sorted with fluorophores conjugated to anti-cow IgG, and biotinylated BG505 SOSIP was used as antigen bait as described previously (Extended Data Fig. 4) 21. Sorting and screening of PBMCs at different timepoints (Extended Data Fig. 5) using different sort strategies (Extended Data Fig. 4) resulted in the isolation of 10 mAbs named NC-Cow1 to NC-Cow10. Sequences and alignments of the heavy and light chain sequences for NC-Cow1 to NC-Cow10 are listed in Supplementary Table 2. Interestingly, all 10 antibodies have ultralong HCDR3s (Fig. 3a)"
Heavy Chain Nucleotide: ATGGGATGGTCATGTATCATCCTTTTTCTAGTAGCAACTGCAACCGGTGTACATTCCAAGGTGCAGCTGCGGGAGTCGGGCCCCAGCCTGGTGAAGCCGTCACAGACCCTCTCCCTCACCTGCATGGTCTCTGGATTCTCATTGAACGACGAGGCTGTAGGCTGGGTCCGCCAGGCTCCAGGGAAGGCGCTGGAGTGGCTCGGTAGTATAGACGCTGGTGGAAGCACAGGCTATAACCCAGGCCTGAAATCCCGACTCAGCATCTCCAAGGACAACTCCAAGAACCAAGTTTCTCTGTCAGTGAGCAGCGTGACAACTGAGGACTCGGCCACATACTACTGTGGTACTGTGCACCAGAGGACACAGCCAAAACAAACTTGTCCTAATGGCTATAGTGATGATAGTGCTCTTCGTTATTACAGTAGATGTTCTGATCGTGATTGTTGGCGTTGTACTGGGACTACGTATTATGATACTTGTCAATGTAGTAGTTATACTTATATTCATACTTACGAATTATACGTCGATGCCTGGGGCCAAGGACTCCTGGTCACCGTCTCCTCA
Light Chain Nucleotide: ATGGGATGGTCATGTATCATCCTTTTTCTAGTAGCAACTGCAACCGGTGTACATCAGGCTGTGCTGACTCAGCCATCATCCGTGTCCGGGTCCCTGGGCCAGAGGGTCTCCATCACCTGCTCTGGAAGCAGCAGCAATGTTGGAAATGGATATGTGAGCTGGTACCAACTGATCCCAGGATCGGCCCCCAGAACCCTCATCTATGGTGACACCAGTCGAGCCTCGGGGGTCCCCGACCGATTCTCCGGCTCCAGGTCTGGGAACACAGCCACCCTGACCATCAGCTCGCTCCAGGCTGAAGACGAGGCAGATTATTTCTGTGCATCTCCTGAGGATAGTAGCAGTAATGCTGTTTTCGGCAGCGGGACCACACTGACCGTCCTG
Host Organism: cow
Clonality: monoclonal
Target(s): HCDR3
Proper citation: International AIDS Vaccine Initiative (IAVI) Cat# NC-Cow4, RRID:AB_2687426 Copy
http://antibodyregistry.org/AB_2687579
Comments: Applications: W, IP, IHC-P, IF-IC, F
Host Organism: rabbit
Clonality: monoclonal
Target(s): LAMP1
Proper citation: Cell Signaling Technology Cat# 9091, RRID:AB_2687579 Copy
http://antibodyregistry.org/AB_2687632
Comments: Image validation available for WB in MDS.
Host Organism: mouse
Clonality: monoclonal
Target(s): Gata6
Proper citation: Abcam Cat# Ab175425, RRID:AB_2687632 Copy
http://antibodyregistry.org/AB_2687528
Host Organism: mouse
Clonality: monoclonal
Target(s): Ki-67
Proper citation: Agilent Cat# M724029, RRID:AB_2687528 Copy
http://antibodyregistry.org/AB_2687509
Comments: Image validation for ICC/IF, WB in MDS.
Host Organism: rabbit
Clonality: monoclonal
Target(s): TGF beta induced factor 2
Proper citation: Abcam Cat# ab155948, RRID:AB_2687509 Copy
http://antibodyregistry.org/AB_2687673
Comments: Kedhgicar et al., in press, submitted life
Host Organism: mouse
Clonality: monoclonal
Target(s): Xenopus leaves rpn1
Proper citation: Dominique Alfandari - University of Massachusetts Amherst Cat# Alfandari-3, RRID:AB_2687673 Copy
Discontinued
Ratings or validation data are available for this resource
http://antibodyregistry.org/AB_2687510
Comments: Discontinued; Applications: remove
Info: Independent validation by the NYU Lagone was performed for: IHC. This antibody was found to have the following characteristics: Functional in human:TRUE, NonFunctional in human:FALSE, Functional in animal:FALSE, NonFunctional in animal:FALSE
Host Organism: mouse
Clonality: monoclonal
Target(s): FUT8
Proper citation: Proteintech Cat# 66118, RRID:AB_2687510 Copy
http://antibodyregistry.org/AB_2687555
Host Organism: mouse
Clonality: monoclonal
Target(s): hnRNP E1
Proper citation: Santa Cruz Biotechnology Cat# sc-393076, RRID:AB_2687555 Copy
Ratings or validation data are available for this resource
http://antibodyregistry.org/AB_2687616
Comments: Applications: W, IP, IHC-P, IF-IC
Info: Independent validation by the NYU Lagone was performed for: IHC. This antibody was found to have the following characteristics: Functional in human:TRUE, NonFunctional in human:FALSE, Functional in animal:FALSE, NonFunctional in animal:FALSE
Host Organism: rabbit
Clonality: monoclonal
Target(s): N-Cadherin
Proper citation: Cell Signaling Technology Cat# 13116, RRID:AB_2687616 Copy
http://antibodyregistry.org/AB_2687488
Comments: Flow cytometry
Host Organism: mouse
Clonality: monoclonal
Target(s): CD183
Proper citation: BD Biosciences Cat# 565223, RRID:AB_2687488 Copy
http://antibodyregistry.org/AB_2687623
Host Organism: mouse
Clonality: monoclonal
Target(s): CD28
Proper citation: Tonbo Biosciences Cat# 50-0289, RRID:AB_2687623 Copy
http://antibodyregistry.org/AB_2687529
Comments: Applications: W, IP, IF-IC, F
Host Organism: rabbit
Clonality: monoclonal
Target(s): iNOS
Proper citation: Cell Signaling Technology Cat# 13120, RRID:AB_2687529 Copy
Ratings or validation data are available for this resource
http://antibodyregistry.org/AB_2687474
Comments: Applications: W, IP
Info: Independent validation by the NYU Lagone was performed for: IHC. This antibody was found to have the following characteristics: Functional in human:FALSE, NonFunctional in human:FALSE, Functional in animal:FALSE, NonFunctional in animal:FALSE
Host Organism: rabbit
Clonality: monoclonal
Target(s): xCT/SLC7A11
Proper citation: Cell Signaling Technology Cat# 12691, RRID:AB_2687474 Copy
http://antibodyregistry.org/AB_2687460
Comments: Image validation for WB in MDS.
Host Organism: mouse
Clonality: monoclonal
Target(s): Ubiquitin
Proper citation: Boston Biochem Cat# A-104, RRID:AB_2687460 Copy
http://antibodyregistry.org/AB_2687668
Comments: Image validation available for WB, ICC/IF, Flow Cyt in MDS.
Host Organism: rabbit
Clonality: monoclonal
Target(s): Synthetic peptide within human snap29 aa 1-100
Proper citation: Abcam Cat# ab181151, RRID:AB_2687668 Copy
http://antibodyregistry.org/AB_2687518
Comments: Applications: W
Host Organism: rabbit
Clonality: monoclonal
Target(s): Phospho-c-Myc (Ser62)
Proper citation: Cell Signaling Technology Cat# 13748, RRID:AB_2687518 Copy
http://antibodyregistry.org/AB_2687503
Comments: Image validation for ICC/IF, WB, IHC-P
Host Organism: rabbit
Clonality: monoclonal
Target(s): CPT2
Proper citation: Abcam Cat# ab181114, RRID:AB_2687503 Copy
http://antibodyregistry.org/AB_2687545
Comments: Intracellular staining (flow Cytotoxicityometry)
Host Organism: mouse
Clonality: monoclonal
Target(s): Mouse RORγt
Proper citation: BD Biosciences Cat# 562894, RRID:AB_2687545 Copy
http://antibodyregistry.org/AB_2687515
Comments: Image validation for WB in MDS.
Host Organism: mouse
Clonality: monoclonal
Target(s): MLL2
Proper citation: Santa Cruz Biotechnology Cat# SC-293217, RRID:AB_2687515 Copy
http://antibodyregistry.org/AB_2687441
Comments: Image validation for WB, IP in MDS. Epitope mapping between amino acids 186-207
Host Organism: mouse
Clonality: monoclonal
Target(s): EDG-2
Proper citation: Santa Cruz Biotechnology Cat# sc-515665, RRID:AB_2687441 Copy
Can't find your Antibody?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific antibody, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your antibody in the search results, please help us by registering it into the system — it's easy. Register it with The Antibody Registry (an Antibody Registry account is required. Create a free Antibody Registry account if you don't have one yet). An RRID will be generated in 1-2 business days.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.