Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00054763
Source Database: WormBase (WB)
Affected Genes: WBGene00010556(rack-1)
Genomic Alteration: WBGene00010556(rack-1)
Availability: unknown
Source References: EMPTY
Synonyms: rack-1(rns8[rack-1::mScarlet]] IV.
Notes: mScarlet tag inserted into endogenous rack-1 locus. Ubiquitous mScarlet expression.
Proper citation: RRID:WB-STRAIN:WBStrain00054763 Copy
http://www.wormbase.org/db/get?name=WBStrain00054762
Source Database: WormBase (WB)
Affected Genes: WBGene00004475(rps-6)
Genomic Alteration: WBGene00004475(rps-6)
Availability: unknown
Source References: PMID:39284915, PMID:39652010
Synonyms: rps-6(rns6[rps-6::mCherry]) I.
Notes: mCherry tag inserted at 3' end of endogenous rps-6 locus. Reduced thermotolence at 35C compared to N2 controls. Reference: Somers H, et al. Cell Reports Methods. (2022) Apr 25;2(4):100203 PMID: 35497499
Proper citation: RRID:WB-STRAIN:WBStrain00054762 Copy
http://www.wormbase.org/db/get?name=WBStrain00054802
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: cyb-2.2(q911[3xMyc::cyb-2.2]) I.
Notes: 3xMyc tag inserted at N-terminus of endogenous cyb-2.2 locus.
Proper citation: RRID:WB-STRAIN:WBStrain00054802 Copy
http://www.wormbase.org/db/get?name=WBStrain00054804
Source Database: WormBase (WB)
Affected Genes: WBGene00000870(cyd-1)
Genomic Alteration: WBGene00000870(cyd-1)
Availability: unknown
Source References: EMPTY
Synonyms: cyd-1(q917[cyd-1::3xMyc]) II.
Notes: Internal 3xMyc tag inserted into endogenous cyd-1 locus.
Proper citation: RRID:WB-STRAIN:WBStrain00054804 Copy
http://www.wormbase.org/db/get?name=WBStrain00054803
Source Database: WormBase (WB)
Affected Genes: WBGene00000868(cyb-3)
Genomic Alteration: WBGene00000868(cyb-3)
Availability: unknown
Source References: EMPTY
Synonyms: cyb-3(q914[cyb-3::3xMyc]) V.
Notes: Internal 3xMyc tag inserted into endogenous cyb-3 locus.
Proper citation: RRID:WB-STRAIN:WBStrain00054803 Copy
http://www.wormbase.org/db/get?name=WBStrain00054764
Source Database: WormBase (WB)
Affected Genes: WBGene00000251(bli-1)
Genomic Alteration: WBGene00000251(bli-1)
Availability: unknown
Source References: PMID:38924277
Synonyms: bli-1(wrd84[bli-1::linker::mNeonGreen::3xFLAG(internal)::linker]) II.
Notes: Internal mNeonGreen::3xFLAG tags with linker sequences inserted into endogenous bli-1 locus. Superficially wild-type. Reference: Johnson LC, et al. Development 2023; dev.201085. doi: https:
Proper citation: RRID:WB-STRAIN:WBStrain00054764 Copy
http://www.wormbase.org/db/get?name=WBStrain00054805
Source Database: WormBase (WB)
Affected Genes: WBGene00000871(cye-1)
Genomic Alteration: WBGene00000871(cye-1)
Availability: unknown
Source References: EMPTY
Synonyms: cye-1(q920[3xMyc::cye-1]) I.
Notes: 3xMyc tag inserted at N-terminus of endogenous cye-1 locus.
Proper citation: RRID:WB-STRAIN:WBStrain00054805 Copy
http://www.wormbase.org/db/get?name=WBStrain00054750
Source Database: WormBase (WB)
Affected Genes: WBGene00004095(pqe-1)
Genomic Alteration: WBGene00004095(pqe-1)
Availability: unknown
Source References: EMPTY
Synonyms: pqe-1(utx65[mScarlet-I-C1::3xMyc::pqe-1]) III.
Notes: Made_by: Ann Houghton (Glow Worms '22)|"N-terminal tag of PQE-1 via CRISPR/Cas9 knock-in of mScarlet at pqe-1 locus. Insertion verified by PCR and fluorescence. Genotyping primers: fwd 5 CCAGATGCGAAAGCGAACAG 3 ; rev 5 TGTACTTACCGGAATCGGCG 3. Left flank: 5' ttaataatcattccagcaagtatctcagcc 3'; Right flank: 5' ATGTTTAATGGCGGCTATGGATCTGGAAAC 3; sgRNA: atctcagccATGTTTAATGG; Cas9/sgRNA plasmid: pGLOW143; mScarlet^SEC^3xMyc plasmid: pGLOW142; SEC insertion allele strain: GLW84."
Proper citation: RRID:WB-STRAIN:WBStrain00054750 Copy
http://www.wormbase.org/db/get?name=WBStrain00054757
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: unknown
Source References: EMPTY
Synonyms: aSi13 II; unc-119(ed3) III.
Notes: aSi13 [lox2272 + loxN 3' (delta)Cbr-unc-119(+) + 3' (delta)mNeonGreen::PEST] aSi14[lox2272 + loxP 3 (delta)HygR + 3 (delta)mScarlet-I::PEST]II. Unc. Strain contains a set of dual specialized safe harbor transgene landing pads for integration of promoters: one driving mScarlet and rescuing hygromycin resistance upon integration, the other driving mNeonGreen and rescuing the unc phenotype upon integration. Reference: Stevenson ZC, et al. bioRxiv 2022.10.30.514301; doi: https:
Proper citation: RRID:WB-STRAIN:WBStrain00054757 Copy
http://www.wormbase.org/db/get?name=WBStrain00054759
Source Database: WormBase (WB)
Affected Genes: WBGene00001454(flp-11)|WBGene00006792(unc-58)
Genomic Alteration: WBGene00001454(flp-11), WBGene00006792(unc-58)
Availability: unknown
Source References: EMPTY
Synonyms: flp-11(syb1445[flp-11::SL2::unc-58(L428F)::linker::mKate2]) X.
Notes: Made_by: Bringmann lab|"unc-58(L428F) was knocked into the endogenous locus of flp-11 to express a sodium channel in RIS that causes strong overactivation of RIS. Reference: Busack I & Bringmann H. PLOS Genetics 19(3): e1010665. https:"
Proper citation: RRID:WB-STRAIN:WBStrain00054759 Copy
http://www.wormbase.org/db/get?name=WBStrain00054754
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: F13E6.1(utx75[F13E6.1::mNG::3xFlag]) X.
Notes: C-terminal tag of F13E6.1 via CRISPR/Cas9 knock-in of mNeonGreen at F13E6.1 locus. Insertion verified by PCR and fluorescence. Genotyping primers: fwd 5 AAATCGTGCTCTCCCAAGCA 3; rev 5 CTTGTCACCTGACGGGATGT 3. Left flank: 5' CCAGTTGCGGAGGAGGCGAAGCCAATCTCT 3' (1 silent mutation); Right flank: 5' TAAattcattcatttcacataccaatatgt 3'; sgRNA: atgaatTTAAGAGATTGGCT; Cas9/sgRNA plasmid: pGLOW26; mNG^SEC^3xFlag plasmid: pGLOW104; SEC insertion allele strain: GLW94.|"Made_by: Gonzalo Botello-Lins (Glow Worms '20)"
Proper citation: RRID:WB-STRAIN:WBStrain00054754 Copy
http://www.wormbase.org/db/get?name=WBStrain00054755
Source Database: WormBase (WB)
Affected Genes: WBGene00004323(rde-1)
Genomic Alteration: WBGene00004323(rde-1)
Availability: unknown
Source References: EMPTY
Synonyms: rde-1(ar660) V.
Notes: Made_by: Justin Shaffer|"rde-1(ar660)[rde-1(flexon)]. 9th intron of rde-1 replaced with a flexon - an artificial exon flanked by artificial introns that each contain a lox2272 site (a flexon). Severely reduces rde-1 function, function can be restored upon excision of the flexon by Cre recombinase. Reference: Shaffer JM & Greenwald I. Proc Natl Acad Sci U S A. 2022 Jan 18;119(3):e2117451119. doi: 10.1073/pnas.2117451119. PMID: 35027456."|"rde-1(ar660)[rde-1(lox2272-flexon-lox2272)]. 9th intron of rde-1 replaced with a flexon - an artificial exon flanked by artificial introns that each contain a lox2272 site (a flexon). Severely reduces rde-1 function, function can be restored upon excision of the flexon by Cre recombinase. Reference: Shaffer JM & Greenwald I. Proc Natl Acad Sci U S A. 2022 Jan 18;119(3):e2117451119. doi: 10.1073/pnas.2117451119. PMID: 35027456."
Proper citation: RRID:WB-STRAIN:WBStrain00054755 Copy
http://www.wormbase.org/db/get?name=WBStrain00054740
Source Database: WormBase (WB)
Affected Genes: WBGene00002123(inx-1)
Genomic Alteration: WBGene00002123(inx-1)
Availability: unknown
Source References: EMPTY
Synonyms: inx-1(tm3524) X.
Notes: Derived by out-crossing parental strain FX18538 five times.|"Made_by: Savannah Sojka"
Proper citation: RRID:WB-STRAIN:WBStrain00054740 Copy
http://www.wormbase.org/db/get?name=WBStrain00054747
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: H34C03.2(utx55[mNG::3xFlag::H34C03.2]) IV.
Notes: Made_by: Christine Collins, Vinay Pillai, Wesley Yeung|"N-terminal tag of H34C03.2 via CRISPR/Cas9 knock-in of mNeonGreen at H34C03.2 locus. Insertion verified by PCR and fluorescence. Left flank: 5' gggattgcctacactcaaatatacgtaacg 3'; Right flank: 5' ATGCCCACGCCGGAAGTGTTCCCATGGATG 3 (4 silent mutations); gRNA: cgtaacgATGCCAACTCCCG; Cas9/sgRNA plasmid: pGLOW9; mNG^SEC^3xFlag plasmid: pGLOW106; SEC insertion allele strain: GLW72."
Proper citation: RRID:WB-STRAIN:WBStrain00054747 Copy
http://www.wormbase.org/db/get?name=WBStrain00054742
Source Database: WormBase (WB)
Affected Genes: WBGene00006747(unc-7)
Genomic Alteration: WBGene00006747(unc-7)
Availability: unknown
Source References: EMPTY
Synonyms: unc-7(e5) X.
Notes: Derived by out-crossing parental strain CB5.|"Made_by: Savannah Sojka"
Proper citation: RRID:WB-STRAIN:WBStrain00054742 Copy
http://www.wormbase.org/db/get?name=WBStrain00054745
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: gjIs140.
Notes: gjIs140 [gpa-4::GFP + dpy-20(+)]. Reporter construct includes 2.5 kb upstream and the first exon of gpa-4 fused in frame with GFP. Reference: Burghoorn et al. Proc. Natl. Acad. Sci. USA 2007 Apr; 104(17):7157-62.|"Made_by: Gert Jansen lab"
Proper citation: RRID:WB-STRAIN:WBStrain00054745 Copy
http://www.wormbase.org/db/get?name=WBStrain00054744
Source Database: WormBase (WB)
Affected Genes: WBGene00001079(dpy-20)
Genomic Alteration: WBGene00001079(dpy-20)
Availability: unknown
Source References: EMPTY
Synonyms: dpy-20(e1282) IV; pkIs1201.
Notes: Made_by: Plasterk lab|"pkIs1201 [gpa-3::GFP + dpy-20(+)]."
Proper citation: RRID:WB-STRAIN:WBStrain00054744 Copy
http://www.wormbase.org/db/get?name=WBStrain00054738
Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00006787(unc-52)|WBGene00006994(zyg-9)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00006787(unc-52), WBGene00006994(zyg-9)
Availability: unknown
Source References: EMPTY
Synonyms: zyg-9(or1985)/mnC1[dpy-10(e128) unc-52(e444) umnIs32] II.
Notes: umnIs32 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. or1985 is a CRISPR/Cas9 engineered deletion of zyg-9 removing the entire open reading frame. Heterozygotes are wild-type and GFP+ and segregate WT GFP+ (hets), or1948 homozygotes (GFP-, lay 100% dead embryos) and paralysed DpyUnc GFP+ (mnC1 homozygotes). Maintain by picking WT GFP+. Reference: Harvey AM, et al. PLoS Genet. 2023 Jan 6;19(1):e1010363. doi: 10.1371/journal.pgen.1010363. PMID: 36608115
Proper citation: RRID:WB-STRAIN:WBStrain00054738 Copy
http://www.wormbase.org/db/get?name=WBStrain00054739
Source Database: WormBase (WB)
Affected Genes: WBGene00002123(inx-1)
Genomic Alteration: WBGene00002123(inx-1)
Availability: unknown
Source References: EMPTY
Synonyms: inx-1(tm6662) X.
Notes: Derived by out-crossing parental strain FX18537 five times.|"Made_by: Savannah Sojka"
Proper citation: RRID:WB-STRAIN:WBStrain00054739 Copy
http://www.wormbase.org/db/get?name=WBStrain00054793
Source Database: WormBase (WB)
Affected Genes: WBGene00006604(tra-1)
Genomic Alteration: WBGene00006604(tra-1)
Availability: unknown
Source References: EMPTY
Synonyms: tra-1(q106) III/eT1[qIs60](III;V).
Notes: qIs60 [pes-10::GFP + gut specific promoter::GFP + myo-2::GFP]. Heterozygotes are wild-type GFP+ and segregate wild-type GFP+ heterozygotes, non-GFP males, and dead eggs (eT1 homozygotes). Pick wild-type GFP+ and check for proper segregation of progeny to maintain. Reference: Schedl T, et al. Genetics. 1989 Dec;123(4):755-69. doi: 10.1093/genetics/123.4.755. PMID: 2612895.
Proper citation: RRID:WB-STRAIN:WBStrain00054793 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
