Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=4139885
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2021-11-03)
Alternate IDs: 4139885
Notes: This strain was produced by injecting ZFNs targeting the sequence ctcccccatcccacttgaatgtggagcagcctgtg into SS/JrHsdMcwi rat embryos. The resulting mutation is an in-frame 6-bp deletion in exon 2.
Proper citation: RRID:RGD_4139885 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=4139889
Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Cryopreserved Embryo (as of 2018-06-06)
Alternate IDs: 4139889
Notes: A rat showing hereditary renal cell carcinoma was found in a Jcl:SD rat colony and named Nihon rat. In this rat strain mutation was identified as an insertion of a cytosine (C) in a C tract within exon 3 of Flcn . This germline mutation results in a frameshift and produces a stop codon 26 amino-acids downstream. Thereafter they have been maintained at Dainippon Sumitomo Pharma Co., Ltd. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_4139889 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=4145089
Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 4145089
Notes: SS/JrHsdMcwi were crossed with SS-6BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain
Proper citation: RRID:RGD_4145089 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=4139892
Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Cryopreserved Embryo
Alternate IDs: 4139892
Notes: In a colony of Donryu rats, Yoshida found a male rat showing hepatomegaly and splenomegaly in 1981. These mutant rats were transferred to Kagoshima University and maintained in heterozygous condition so far. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_4139892 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=4140404
Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Live Animals (as of 2021-04-29)
Alternate IDs: 4140404
Notes: Dr. Susumu Makino and his colleagues found several animals that had gait abnormalities among Wistar rats maintained at Shionogi Co. They named these animals osteogenic disorder (OD) rats because they exhibited prominent bone and joint abnormalities and systemic bleeding. Subsequent studies revealed that these symptoms were derived from an ascorbic acid (vitamin C) deficiency arising from defective gulonolactone oxidase (GLO) activity. This characteristic was confirmed to be the result of a mutation involving the autosomal single recessive gene od. Scurvy due to L-gulonolactone oxidase deficincy; phenotype normalizes if supplied with ascorbic acid 300mg/kg/d. od/od rats are more susceptible to dental caries as compared with +/+ rats, in only amoun parous females. CLEA Japan, Inc
Proper citation: RRID:RGD_4140404 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=4140409
Source Database: Rat Genome Database (RGD)
Genetic Background: consomic
Availability: Unknown
Alternate IDs: 4140409
Notes: Transfer of the DA-rat chromosome 16 (RNO16) into the COP-rat background
Proper citation: RRID:RGD_4140409 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=4140408
Source Database: Rat Genome Database (RGD)
Genetic Background: recombinant_inbred
Availability: Cryopreserved Embryo
Alternate IDs: 4140408
Notes: The LEXF/FXLE RI strain set has been established by Shisa et al at Saitama Cancer Center Research Institute since 1985. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_4140408 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=4891165
Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 4891165
Notes: These are congenic wiggling rats established by transferring the wiggling gene from Long-Evans Cinnamon (LEC) to Wistar King-Aptekman/Hokkaido (WKAH) strain
Proper citation: RRID:RGD_4891165 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=4142540
Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Cryopreserved Sperm
Alternate IDs: 4142540
Notes: This congenic strain was established by crossing between WKY/Izm and SHR/Izm in 2001. Heterozygous consomic rats were established in 2004, homozygous consomic rats were established in 2005, and homozygous congenic rats were established by crossing among consomic heterozygous rats in 2009. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_4142540 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=2325754
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 2325754
Notes: Autosomal dominant mutation that arose spontaneously in SD rats. Genomic DNA analysis from mutants revealed a single base(G) insertion in the exon generating a novel 5' donor splice site. This led to the internal a 602-bp deletion of Pax6 mRNA.
Proper citation: RRID:RGD_2325754 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=4145374
Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 4145374
Notes: Congenic strain developed by crossing ACI.FHH-(D1Rat74-D1Rat90)/Eur (Rf-1a) males to ACI.FHH-(D1Mit18-D1Rat90)(D14Mit11-D14Rat33)(D14Rat65-D14Rat90)/EurMcwi (Rf-1a+4) double congenic females
Proper citation: RRID:RGD_4145374 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=4142545
Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Cryopreserved Sperm
Alternate IDs: 4142545
Notes: This congenic strain was established by crossing between WKY/Izm and SHR/Izm in 2001. Heterozygous consomic rats were established in 2004, homozygous consomic rats were established in 2005, and homozygous congenic rats were established by crossing among consomic heterozygous rats in 2009. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_4142545 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=4142546
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Embryo
Alternate IDs: 4142546
Notes: Rats which showed a dental mutation such as morphological abnormalities of the teeth were found in the SHR-SP rats at Daiichi Seiyaku, Co., Ltd. in 1981. Transferred to Tokushima University in 2003. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_4142546 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=4142541
Source Database: Rat Genome Database (RGD)
Genetic Background: transgenic
Availability: Cryopreserved Embryo; Cryopreserved Sperm
Alternate IDs: 4142541
Notes: This transgenic strain was generated by microinjection into fertilized oocytes of Wistar rats. The vector containing the Tek/GFP plasmid (pSP14/15.t2hgfpPan5) was a gift from Dr. TN Sato of University of Texas Southwestern Medical Center at Dallas. The transgene was excised from the plasmid vector by Sal I digestion. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_4142541 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=4142543
Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Cryopreserved Embryo; Cryopreserved Sperm
Alternate IDs: 4142543
Notes: The Gluco13 region, one of the significant QTL for glucose intolerance of SDT/Jcl was transferred onto the genetic background of BN/Seac strain. Established by speed congenic method since 2003 and afterwards maintained by sib mating (N6F11, July 2010). Please refer to STD.BN-Gluco13/Nyo. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_4142543 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=4142544
Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Cryopreserved Embryo (as of 2024-09-24)
Alternate IDs: 4142544
Notes: A WKY rat showing higher serum adiponectin concentration was found in Department of Pathology, Kinki University School of Medicine. In 1974, this strain was transferred from Dr. Okamoto to Kyoto University. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_4142544 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=4142550
Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Cryopreserved Sperm
Alternate IDs: 4142550
Notes: This congenic strain was established by crossing between WKY/Izm and SHR/Izm in 2001. Heterozygous consomic rats were established in 2004, homozygous consomic rats were established in 2005, and homozygous congenic rats were established by crossing among consomic heterozygous rats in 2009. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_4142550 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=4142799
Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 4142799
Notes: LEW/Crlc and SS/Jr were backcrossed for 5 generations, then BC5 rat was mated with SS/Jr to produce the desired congenic strain
Proper citation: RRID:RGD_4142799 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=4140413
Source Database: Rat Genome Database (RGD)
Genetic Background: recombinant_inbred
Availability: Cryopreserved Embryo
Alternate IDs: 4140413
Notes: The LEXF/FXLE RI strain set has been established by Shisa et al at Saitama Cancer Center Research Institute since 1985. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_4140413 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5131920
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Extinct
Alternate IDs: 5131920
Notes: This strain was produced by injecting ZFNs targeting the sequence CAGGCCCTGAACCGCttctggGATTACCTGCGCTGGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 24-bp frameshift deletion in exon 2.
Proper citation: RRID:RGD_5131920 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.