Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10054307
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals; Cryopreserved Sperm (as of 2021-11-03)
Alternate IDs: 10054307
Notes: The Btg2 mutant rats were generated using transcription activator-like effector nuclease (TALEN) constructs specific for the rat Btg2 gene designed to target exon 1 using the target sequence TAGGTTTCCTCACCAGTCtcctgaggactcggggcTGCGTGAGCGAGCAGAGA. The result was a 44-bp deletion mutation in exon 1 (RNO13:50,916,769-50,916,812; aaaccttgagtctctgctcgctcacgcagccccgagtcctcagg) of SS.BN-(D13Rat25-rs106935835)/Mcwi rat embryos. Contact MCW rat distribution at [email protected]
Proper citation: RRID:RGD_10054307 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10054433
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2018-10-22)
Alternate IDs: 10054433
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Pkd1 gene of LEW/NCrl rat embryos. The resulting mutation is a 12-bp deletion in the Pkd1 gene. Contact MCW rat distribution at [email protected]
Proper citation: RRID:RGD_10054433 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=8552255
Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Cryopreserved Embryo
Alternate IDs: 8552255
Notes: Developed by the DEPOSITOR National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_8552255 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=11073719
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 11073719
Notes: CRISPR/Cas9 system was used to generate this mutant; sgRNA+Cas9+ plasmid was injected into zygote of SD rat that added a 2A-Chr2-EYFP behind the stop codon of Drd1. Institute of Neuroscience, Chinese Academy of Sciences
Proper citation: RRID:RGD_11073719 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10413856
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 10413856
Notes: This strain was produced by injecting ZFNs into SD embryos. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 20-bp deletion from cDNA position 30-49 (GAGAGTCCTGCGCAGGCCTG). The mutation is predicted to cause out of frame translation and a premature stop codon. No protein in the homozygous mutant was detected by immunostaining.
Proper citation: RRID:RGD_10413856 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10054279
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 10054279
Notes: CRISPR/Cas9 system was used to generate this mutant; sgRNA+Cas9+ plasmid was injected into zygote of SD rat that added a 2A ( the self-cleaving 2A peptide sequence from foot-and-mouth disease virus or other picornaviruses), blue light-gated cation channel channelrhodopsin-2 (ChR2) and EYFP behind the last exon of Gfap. Institute of Neuroscience, Chinese Academy of Sciences
Proper citation: RRID:RGD_10054279 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10054276
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 10054276
Notes: CRISPR/Cas9 system was used to generate this mutant; sgRNA+Cas9+Oligo was injected into zygote of SD rat that made the 155th amino acid Arg into His
Proper citation: RRID:RGD_10054276 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=8551732
Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 8551732
Notes: A double congenic strain derived from the progenitor strain SS.LEW-(D17Chm31-D17Chm93)/Ayd and SS.LEW-(D10Chm10-D10Rat11)/Ayd
Proper citation: RRID:RGD_8551732 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=8551730
Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 8551730
Notes: A double congenic strain derived from the progenitor strain SS.LEW-(D3Rat2-D3Chm79)/Ayd and SS.LEW-(D10Chm10-D10Rat11)/Ayd
Proper citation: RRID:RGD_8551730 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10395297
Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Live Animals (as of 2024-08-06)
Alternate IDs: 10395297
Notes: Generated by selective brother x sister breeding of 18 non-diabetic Jcl:Wistar rats which were glucose intolerant on oral glucose tolerant tests. This colony is from F36 generation of the Japanese colony provided by Drs. Suzuki and Toyota of Tokoku University , Sendai Japan. Now bred and maintained at Medical College of Wisconsin RGD HRDP, contact HRDP
Proper citation: RRID:RGD_10395297 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10401851
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 10401851
Notes: CRISPR/Cas9 system was used to generate this mutant. This mutant strain has increased body weight, increased circulating cholesterol level and increased triglyceride level compared to its littermates
Proper citation: RRID:RGD_10401851 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=8551734
Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 8551734
Notes: A double congenic strain derived from the progenitor strain SS.LEW-(D17Chm31-D17Chm93)/Ayd and SS.LEW-(D17Rat84-D17Chm17)/Ayd
Proper citation: RRID:RGD_8551734 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=8657135
Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 8657135
Notes: A sub congenic strain derived from the progenitor strain SS.LEW-(D10Chm224-D10Chm6)/Ayd
Proper citation: RRID:RGD_8657135 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=8551742
Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 8551742
Notes: A double congenic strain derived from the progenitor strain SS.LEW-(D16Chm48-D16Chm60)/Ayd and SS.LEW-(D18Rat101-D18Rat92)/Ayd
Proper citation: RRID:RGD_8551742 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=11354928
Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 11354928
Notes: This is a congenic substrain developed by crossing SS.SHR-(D9Rat7-D9Rat84)/Mco to SS/Jr and the F1 were intercrossed to produce an F2 population,which was genotyped using microsatellite markers. The selected recombinant rats were crossed to SS/Jr again to duplicate the recombinant region.
Proper citation: RRID:RGD_11354928 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=11354926
Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 11354926
Notes: This is a congenic substrain developed by crossing SS.SHR-(D9Rat7-D9Rat84)/Mco to SS/Jr and the F1 were intercrossed to produce an F2 population,which was genotyped using microsatellite markers. The selected recombinant rats were crossed to SS/Jr again to duplicate the recombinant region.
Proper citation: RRID:RGD_11354926 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=11040521
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 11040521
Notes: ZFN mutant founders were backcrossed with SHR/NCrl to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.
Proper citation: RRID:RGD_11040521 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10045548
Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Unknown
Alternate IDs: 10045548
Notes: Original breeders are from a colony at Hadassah University Hospital, Jerusalem, Israel: Professor Cohen AM et al. initiated the Cohen diabetic (CD) rat model at the Hadassah University Hospital in the 1950s to examine the role of constitutional (genetic) and environmental (dietary) factors in the development of type 2 diabetes mellitus. Since 1996, the original colony underwent a secondary inbreeding by Dr. Sarah Zangen designated by Prof. Cohen as responsible for the Cohen diabetic (CD) rat colony.
Proper citation: RRID:RGD_10045548 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10402395
Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Unknown
Alternate IDs: 10402395
Notes: This is a result of a cross of the BNW and HPE, this spontaneous hairless black skin mutation was selected from the F2 offspring for the black hairless quality and subsequently bred brother x sister
Proper citation: RRID:RGD_10402395 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10059635
Source Database: Rat Genome Database (RGD)
Genetic Background: transgenic
Availability: Unknown
Alternate IDs: 10059635
Notes: generated by Dr. Masugi Nishihara's group
Proper citation: RRID:RGD_10059635 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.