Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

On page 82 showing 1621 ~ 1640 out of 4,651 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=2317813

Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 2317813
Notes: This sub-congenic was developed by crossing AT.ANT-(D1Rat234-D1Rat228)/Rar with AT

Proper citation: RRID:RGD_2317813 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=2317822

Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 2317822
Notes: This sub-congenic was developed by crossing AT.ANT-(D1Rat234-D1Rat228)/Rar with AT

Proper citation: RRID:RGD_2317822 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=2317820

Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 2317820
Notes: This sub-congenic was developed by crossing AT.ANT-(D1Rat234-D1Rat288)/Rar with AT

Proper citation: RRID:RGD_2317820 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=2317827

Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 2317827
Notes: This sub-congenic was developed by crossing AT.ANT-(D1Rat234-D1Rat228)/Rar with AT

Proper citation: RRID:RGD_2317827 Copy   


  • RRID:RGD_2325206

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=2325206

Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Unknown
Alternate IDs: 2325206
Notes: Substrain of LEW, from Dr Margaret Lewis from Wistar stock in early 1950s to Seac Yoshitomi, LTD Japan

Proper citation: RRID:RGD_2325206 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=2317791

Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 2317791
Notes: Congenic substrain established by intercrossing DA.PVG.1AV1-(D4Rat155-Spr) with parental DA/Kini

Proper citation: RRID:RGD_2317791 Copy   


  • RRID:RGD_2325202

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=2325202

Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Cryopreserved Embryo; Cryopreserved Sperm
Alternate IDs: 2325202
Notes: Substrain of Dahl SS, from a Sprague-Dawley outbred colony, selected for sensitivity to salt-induced hypertension developed at Kyudo Co.,Ltd (http://www.kyudo.co.jp/) to Seac Yoshitomi, LTD Japan, now maintained at NBRP National BioResource Project for the Rat in Japan

Proper citation: RRID:RGD_2325202 Copy   


  • RRID:RGD_4889464

    This resource has 1+ mentions.

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=4889464

Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Unknown
Alternate IDs: 4889464
Notes: Original breeders are from a colony in Paris (CNRS URA 307, Paris, France) which were obtained in 1995 and since then bred locally in Oxford, UK

Proper citation: RRID:RGD_4889464 Copy   


  • RRID:RGD_4891107

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=4891107

Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Unknown
Alternate IDs: 4891107
Notes: 3 pairs of WKY males and females with lowest immobility and highest climbing scores in the forced swim test were mated. Dept. of Psychiatry and Behavioral Sciences, Northwestern University Feinberg School of Medicine, Chicago, Illinois. Rat Resource and Research Center

Proper citation: RRID:RGD_4891107 Copy   


  • RRID:RGD_4891103

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=4891103

Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Unknown
Alternate IDs: 4891103
Notes: 3 pairs of WKY males and females with highest immobility and lowest climbing scores in the forced swim test were mated. Dept. of Psychiatry and Behavioral Sciences, Northwestern University Feinberg School of Medicine, Chicago, Illinois. Rat Resource and Research Center

Proper citation: RRID:RGD_4891103 Copy   


  • RRID:RGD_4139880

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=4139880

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals; Cryopreserved Sperm (as of 2017-01-26)
Alternate IDs: 4139880
Notes: This strain was produced by injecting ZFNs targeting the sequence acccttcatgctggccaagtttgacggggttctgggcatg into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 5.

Proper citation: RRID:RGD_4139880 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=4143458

Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 4143458
Notes: This congenic strain is derived from GK rats which were from a colony in Paris (CNRS) obtained in 1995. BN rats were initially obtained from Charles River Laboratories, Margate, UK.

Proper citation: RRID:RGD_4143458 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=4143457

Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 4143457
Notes: This congenic strain is derived from GK rats which were from a colony in Paris (CNRS) obtained in 1995. BN rats were initially obtained from Charles River Laboratories, Margate, UK.

Proper citation: RRID:RGD_4143457 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=4143456

Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 4143456
Notes: This congenic strain is derived from GK rats which were from a colony in Paris (CNRS) obtained in 1995. BN rats were initially obtained from Charles River Laboratories, Margate, UK.

Proper citation: RRID:RGD_4143456 Copy   


  • RRID:RGD_4139883

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=4139883

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals; Cryopreserved Sperm (as of 2017-01-26)
Alternate IDs: 4139883
Notes: This strain was produced by injecting ZFNs targeting the sequence ggttacagcttctacctatgcaataaggtaagggtc into SS/JrHsdMcwi rat embryos. The resulting mutation is an 8-bp frameshift deletion in exon 7.

Proper citation: RRID:RGD_4139883 Copy   


  • RRID:RGD_4139885

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=4139885

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2021-11-03)
Alternate IDs: 4139885
Notes: This strain was produced by injecting ZFNs targeting the sequence ctcccccatcccacttgaatgtggagcagcctgtg into SS/JrHsdMcwi rat embryos. The resulting mutation is an in-frame 6-bp deletion in exon 2.

Proper citation: RRID:RGD_4139885 Copy   


  • RRID:RGD_4139889

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=4139889

Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Cryopreserved Embryo (as of 2018-06-06)
Alternate IDs: 4139889
Notes: A rat showing hereditary renal cell carcinoma was found in a Jcl:SD rat colony and named Nihon rat. In this rat strain mutation was identified as an insertion of a cytosine (C) in a C tract within exon 3 of Flcn . This germline mutation results in a frameshift and produces a stop codon 26 amino-acids downstream. Thereafter they have been maintained at Dainippon Sumitomo Pharma Co., Ltd. National BioResource Project for the Rat in Japan

Proper citation: RRID:RGD_4139889 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=4145089

Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 4145089
Notes: SS/JrHsdMcwi were crossed with SS-6BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain

Proper citation: RRID:RGD_4145089 Copy   


  • RRID:RGD_4139892

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=4139892

Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Cryopreserved Embryo
Alternate IDs: 4139892
Notes: In a colony of Donryu rats, Yoshida found a male rat showing hepatomegaly and splenomegaly in 1981. These mutant rats were transferred to Kagoshima University and maintained in heterozygous condition so far. National BioResource Project for the Rat in Japan

Proper citation: RRID:RGD_4139892 Copy   


  • RRID:RGD_4140404

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=4140404

Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Live Animals (as of 2021-04-29)
Alternate IDs: 4140404
Notes: Dr. Susumu Makino and his colleagues found several animals that had gait abnormalities among Wistar rats maintained at Shionogi Co. They named these animals osteogenic disorder (OD) rats because they exhibited prominent bone and joint abnormalities and systemic bleeding. Subsequent studies revealed that these symptoms were derived from an ascorbic acid (vitamin C) deficiency arising from defective gulonolactone oxidase (GLO) activity. This characteristic was confirmed to be the result of a mutation involving the autosomal single recessive gene od. Scurvy due to L-gulonolactone oxidase deficincy; phenotype normalizes if supplied with ascorbic acid 300mg/kg/d. od/od rats are more susceptible to dental caries as compared with +/+ rats, in only amoun parous females. CLEA Japan, Inc

Proper citation: RRID:RGD_4140404 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X