Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

On page 81 showing 1601 ~ 1620 out of 64,152 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.wormbase.org/db/get?name=WBStrain00048919

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:34549171
Synonyms: eri-1(mg366) him-8(e1489) LG IV
Notes: [2021-09-04T05:54:39.739Z WBPerson712] New Strain: WBPaper00061881 10.17912/micropub.biology.000455 EL502 eri-1(mg366) him-8(e1489) LG IV

Proper citation: RRID:WB-STRAIN:WBStrain00048919 Copy   


http://www.wormbase.org/db/get?name=WBStrain00048872

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:34549175
Synonyms: jsSi1651 [mec-4p TS wK+ (MV)GFP-C1 let-858 3Prime jsTi4153] I; him-8(e1489) IV.
Notes: [2021-08-18T04:24:08.908Z WBPerson712] New Strain: WBPaper00061752 jsSi1651 [mec-4p TS wK+ (MV)GFP-C1 let-858 3Prime jsTi4153] I; him-8(e1489) IV

Proper citation: RRID:WB-STRAIN:WBStrain00048872 Copy   


http://www.wormbase.org/db/get?name=WBStrain00048873

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:34549175
Synonyms: jsSi1652 [mec-4p TS wK+ (MV)GFP-C1 let-858 3Prime jsTi4153] I; him-8(e1489) IV.
Notes: [2021-08-18T04:26:35.789Z WBPerson712] New Strain: WBPaper00061752 jsSi1652 [mec-4p TS wK+ (MV)GFP-C1 let-858 3Prime jsTi4153] I; him-8(e1489) IV

Proper citation: RRID:WB-STRAIN:WBStrain00048873 Copy   


http://www.wormbase.org/db/get?name=WBStrain00048875

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:31806663
Synonyms: nhr-67(bmd212[nhr-67p::NHR-67::TagRFP-T::AID]) IV; hlh-2(bmd90[hlh-2p::LoxP::GFP::HLH-2]) I.
Notes: [2021-08-25T18:09:02.645Z WBPerson712] New Strain: https://www.ncbi.nlm.nih.gov/pubmed/31806663 nhr-67(bmd212[nhr-67p::NHR-67::TagRFP-T::AID]) IV; hlh-2(bmd90[hlh-2p::LoxP::GFP::HLH-2]) I

Proper citation: RRID:WB-STRAIN:WBStrain00048875 Copy   


http://www.wormbase.org/db/get?name=WBStrain00048876

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:31806663
Synonyms: hlh-2(bmd231[hlh-2p(Δ-1303-702)>LoxP::GFP::HLH-2]) I; qyIs225[cdh-3p::mCherry::moeABD] V; qyIs7[laminin::GFP] X.
Notes: [2021-08-25T18:09:57.634Z WBPerson712] New Strain:www.ncbi.nlm.nih.gov/pubmed/31806663 hlh-2(bmd231[hlh-2p(Δ-1303-702)>LoxP::GFP::HLH-2]) I; qyIs225[cdh-3p::mCherry::moeABD] V; qyIs7[laminin::GFP] X

Proper citation: RRID:WB-STRAIN:WBStrain00048876 Copy   


http://www.wormbase.org/db/get?name=WBStrain00048878

Source Database: WormBase (WB)
Availability: unknown
Source References: WBPaper00061838(PMID:EMPTY)
Synonyms: pgrn-1(tm985); muIs213[pgrn-1p::pgrn-1::rfp]
Notes: [2021-08-26T16:41:57.096Z WBPerson712] New Strain: 10.17912/micropub.biology.000304. WBPaper00061838 CF3778: pgrn-1(tm985); muIs213[pgrn-1p::pgrn-1::rfp]

Proper citation: RRID:WB-STRAIN:WBStrain00048878 Copy   


http://www.wormbase.org/db/get?name=WBStrain00048890

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:34549175
Synonyms: jsSi1518 [mosL loxP UAS 11X Δpes-10 GFP-C1 tbb-2 3Prime FRT3 mosR jsTi1453] I; jsSi1588 [mosL loxP mec-4p GAL4SK-L-QFAD act-4 3Prime FRT3 mosR jsTi1493] IV.
Notes: [2021-09-03T06:17:36.226Z WBPerson712] New Strain: WBPaper00061752 10.17912/micropub.biology.000438 jsSi1518 [mosL loxP UAS 11X Δpes-10 GFP-C1 tbb-2 3Prime FRT3 mosR jsTi1453] I; jsSi1588 [mosL loxP mec-4p GAL4SK-L-QFAD act-4 3Prime FRT3 mosR jsTi1493] IV

Proper citation: RRID:WB-STRAIN:WBStrain00048890 Copy   


http://www.wormbase.org/db/get?name=WBStrain00048892

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:34549175
Synonyms: jsSi1543 [mosL loxP tetO 7X;mec-7p GFP-C1 tbb-2 3Prime FRT3 mosR jsTi1453] I; jsSi1661 [mosL loxP mec-4p tetR-LL-QFAD act-4 3Prime FR T3 mosR 3Prime jsTi1493] IV.
Notes: [2021-09-03T06:20:02.347Z WBPerson712] New Strain: WBPaper00061752 10.17912/micropub.biology.000438 jsSi1543 [mosL loxP tetO 7X ;mec-7p GFP-C1 tbb-2 3Prime FRT3 mosR jsTi1453] I; jsSi1661 [mosL loxP mec-4p tetR-LL-QFAD act-4 3Prime FRT3 mosR 3Prime jsTi1493] IV

Proper citation: RRID:WB-STRAIN:WBStrain00048892 Copy   


http://www.wormbase.org/db/get?name=WBStrain00048927

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:33997659
Synonyms: [mec-4(+u86m3)p GFP-C1 tbb-2 3Prime UTR jsTi1453] I; him-8(e1489) IV.
Notes: [2021-09-11T15:43:59.029Z WBPerson712] New Strain: WBPaper00061384 jsTi1453 jsSi1572 [mec-4(+u86m3)p GFP-C1 tbb-2 3Prime UTR jsTi1453] I; him-8(e1489) IV

Proper citation: RRID:WB-STRAIN:WBStrain00048927 Copy   


http://www.wormbase.org/db/get?name=WBStrain00048928

Source Database: WormBase (WB)
Affected Genes: WBGene00017317(attf-2)
Genomic Alteration: WBGene00017317(attf-2)
Availability: unknown
Source References: PMID:34549176
Synonyms: attf-2(utx2[mNG::attf-2]) V.
Notes: Made_by: George Huang (Glow Worms '20)|"Superficially wild-type. N-terminal tag of ATTF-2 via CRISPR/Cas9 knock-in of mNeonGreen at attf-2 locus. Insertion verified by PCR. Left flank: 5' cttttttgctcacatcatcatttttcagtc 3'; Right flank: 5' ATGTCGGCCGAGACCGCGACTATCCCCGAAGTTTC 3' (5 silent mutations). sgRNA: 5' CGAAACTGCAACCATACCCG 3'"|"[2021-09-13T17:00:57.295Z WBPerson712] New Strain: WBPaper00061893. 10.17912/micropub.biology.000460 attf-2(utx2[mNG::attf-2)]"|"[2021-09-13T17:00:57.295Z WBPerson712] New Strain: WBPaper00061893. 10.17912/micropub.biology.000460 attf-2(utx2[mNG::attf-2)]"

Proper citation: RRID:WB-STRAIN:WBStrain00048928 Copy   


http://www.wormbase.org/db/get?name=WBStrain00048882

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:34549175
Synonyms: jsSi1518 [mosL loxP 11X UAS Δpes-10p GFP-C1 tbb-2 3Prime FRT3 mosR jsTi1453] I; him-8(e1489) IV.
Notes: [2021-09-03T06:07:35.056Z WBPerson712] New Strain: WBPaper00061752 10.17912/micropub.biology.000438 jsSi1518 [mosL loxP 11X UAS Δpes-10p GFP-C1 tbb-2 3Prime FRT3 mosR jsTi1453] I; him-8(e1489) IV

Proper citation: RRID:WB-STRAIN:WBStrain00048882 Copy   


http://www.wormbase.org/db/get?name=WBStrain00048885

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:34549175
Synonyms: jsTi1453 jsSi1518 I; jsTi1493 jsSi1515 IV.
Notes: jsTi1453 [LoxP::rpl-28p::FRT::GFP::his-58::FRT3] I. jsSi1518 [LoxP::UAS 11X::(delta)pes-10p::GFP-C1::FRT3] I. jsTi1493 [LoxP::mex-5p::FLP:SL2::mNeonGreen::rpl-28p::FRT::GFP::his-58::FRT3] IV. jsSi1515 [LoxP::mec-4p::GAL4-QF::FRT3] IV. RMCE derived single copy UAS GFP-C1 reporter line on Chr I and RMCE derived single copy mec-4p GAL-4-QF driver on Chr IV. Reference: Nonet ML. Genetics. 2020.|"[2021-09-03T06:10:14.947Z WBPerson712] New Strain: WBPaper00061752 10.17912/micropub.biology.000438 jsSi1518 loxP UAS 11X Δpes-10p GFP-C1 tbb-2 3' FRT3 mosR @jsTi1453] I; jsSi1515 [mosL loxP mec-4p GAL4SK-QF tbb-2 3 FRT3 mosR @jsTi1493] IV"|"[2021-09-03T06:10:14.947Z WBPerson712] New Strain: WBPaper00061752 10.17912/micropub.biology.000438 jsSi1518 loxP UAS 11X Δpes-10p GFP-C1 tbb-2 3' FRT3 mosR @jsTi1453] I; jsSi1515 [mosL loxP mec-4p GAL4SK-QF tbb-2 3prime FRT3 mosR @jsTi1493] IV"|"[2021-09-03T06:10:14.947Z WBPerson712] New Strain: WBPaper00061752 10.17912/micropub.biology.000438 jsSi1518 loxP UAS 11X Δpes-10p GFP-C1 tbb-2 3Prime FRT3 mosR jsTi1453] I; jsSi1515 [mosL loxP mec-4p GAL4SK-QF tbb-2 3prime FRT3 mosR jsTi1493] IV"

Proper citation: RRID:WB-STRAIN:WBStrain00048885 Copy   


http://www.wormbase.org/db/get?name=WBStrain00048888

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:34549175
Synonyms: jsSi1518 [mosL loxP UAS 11X Δpes-10p GFP-C1 tbb-2 3Prime FRT3 mosR jsTi1453] I; jsSi1525 [mosL loxP mec-4p GAL4SK-VP64 tbb-2 3prime FRT3 mosR jsTi1493] IV.
Notes: [2021-09-03T06:14:25.203Z WBPerson712] New Strain: WBPaper00061752 10.17912/micropub.biology.000438 jsSi1518 [mosL loxP UAS 11X Δpes-10p GFP-C1 tbb-2 3Prime FRT3 mosR jsTi1453] I; jsSi1525 [mosL loxP mec-4p GAL4SK-VP64 tbb-2 3prime FRT3 mosR jsTi1493] IV

Proper citation: RRID:WB-STRAIN:WBStrain00048888 Copy   


http://www.wormbase.org/db/get?name=WBStrain00048921

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:34549171
Synonyms: csr-1(om135) him-8(e1489)/mIs11 him8(om133) LGIV.
Notes: [2021-09-04T05:55:17.936Z WBPerson712] New Strain: WBPaper00061881 10.17912/micropub.biology.000455 EL609 csr-1(om135) him-8(e1489)/mIs11 him8(om133) LGIV

Proper citation: RRID:WB-STRAIN:WBStrain00048921 Copy   


http://www.wormbase.org/db/get?name=WBStrain00048922

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:34549171
Synonyms: pup-1/-2(om129)/qC1gfp;him-8(e1489) LGIII;IV.
Notes: [2021-09-04T05:55:42.765Z WBPerson712] New Strain: WBPaper00061881 10.17912/micropub.biology.000455 EL624 pup-1/-2(om129)/qC1gfp;him-8(e1489) LGIII;IV

Proper citation: RRID:WB-STRAIN:WBStrain00048922 Copy   


http://www.wormbase.org/db/get?name=WBStrain00048858

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:34549175
Synonyms: sSi1556 [mec-4p (MV)GFP-C1 tbb-2 3prime jsTi1453] I; him-8(e1489) IV.
Notes: [2021-08-18T00:28:27.223Z WBPerson712] New Strain: WBPaper00061752 jsSi1556 [mec-4p (MV)GFP-C1 tbb-2 3 @jsTi1453] I; him-8(e1489) IV|"[2021-08-18T00:28:27.223Z WBPerson712] New Strain: WBPaper00061752 jsSi1556 [mec-4p (MV)GFP-C1 tbb-2 3prime @jsTi1453] I; him-8(e1489) IV"|"[2021-08-18T00:28:27.223Z WBPerson712] New Strain: WBPaper00061752 jsSi1556 [mec-4p (MV)GFP-C1 tbb-2 3prime jsTi1453] I; him-8(e1489) IV"

Proper citation: RRID:WB-STRAIN:WBStrain00048858 Copy   


http://www.wormbase.org/db/get?name=WBStrain00048852

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:34172445
Synonyms: hpIs228[rgef-1p::FUS(R522G)::GFP]
Notes: [2021-08-10T00:12:50.289Z WBPerson324] New Strain: WBPaper00061562 Genotype: hpIs228[rgef-1p::FUS(R522G)::GFP]

Proper citation: RRID:WB-STRAIN:WBStrain00048852 Copy   


http://www.wormbase.org/db/get?name=WBStrain00048854

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37118550
Synonyms: (rmIs284[F25B3.3p::Q67::YFP];sid-1(pk3321)V;uIs69[pCFJ90(myo-2p::mCherry) + unc-119p::sid-1])
Notes: [2021-08-10T00:24:00.179Z WBPerson324] New Strain: WBPaper00061562; Genotype: (rmIs284[F25B3.3p::Q67::YFP]; sid-1(pk3321)V;uIs69[pCFJ90(myo-2p::mCherry) + unc-119p::sid-1])

Proper citation: RRID:WB-STRAIN:WBStrain00048854 Copy   


  • RRID:WB-STRAIN:WBStrain00048855

http://www.wormbase.org/db/get?name=WBStrain00048855

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: jsTi1453 I; bqSi711 IV.
Notes: jsTi1453 [LoxP::rpl-28p::FRT::GFP::his-58::FRT3] I. bqSi711 [mex-5p::FLP::SL2::mNG + unc-119(+)] IV. jsTi1453 is an RMCE landing site inserted using miniMos on Chr I at 11,933,068 ( at 13.1 m.u.) between R06C1.4 and R06C1.6. Insertion site ccctactatcaacgcaaaaactatttggcttttactTAaacataacgttttgaatttgaaaatcaaaaag with rpl-28p trancription toward R06C1.4. bqSi711 expresses nNeonGreen in germline and early embryo. Reference: Nonet ML. Genetics. 2020.|"[2021-08-18T00:14:50.286Z WBPerson712] New Strain: jsTi1453 [mosL loxP rpl-28 FRT GFP-hIs-58 FRT3 mosR]I; bqSi711 [unc-119(+) Pmex-5::FLP::SL2::mNG @cxTi10882]IV WBPaper00059835"|"[2021-08-18T00:14:50.286Z WBPerson712] New Strain: jsTi1453 [mosL loxP rpl-28 FRT GFP-hIs-58 FRT3 mosR]I; bqSi711 [unc-119(+) Pmex-5::FLP::SL2::mNG cxTi10882]IV WBPaper00059835"

Proper citation: RRID:WB-STRAIN:WBStrain00048855 Copy   


http://www.wormbase.org/db/get?name=WBStrain00048856

Source Database: WormBase (WB)
Affected Genes: WBGene00001867(him-8)
Genomic Alteration: WBGene00001867(him-8)
Availability: unknown
Source References: PMID:32513816
Synonyms: jsTi1453 I; him-8(e1489) IV.
Notes: jsTi1453 [LoxP::rpl-28p::FRT::GFP::his-58::FRT3] I. jsTi1453 is an RMCE landing site inserted using miniMos located on Chr I at 11,933,068 (at 13.1 m.u.) between R06C1.4 and R06C1.6. Insertion site ccctactatcaacgcaaaaactatttggcttttactTAaacataacgttttgaatttgaaaatcaaaaag with rpl-28p trancription toward R06C1.4. Reference: Nonet ML. Genetics. 2020.|"[2021-08-18T00:15:43.194Z WBPerson712] New Strain: WBPaper00059835 jsTi1453 I; him-8(e1489) IV"

Proper citation: RRID:WB-STRAIN:WBStrain00048856 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X