Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

On page 77 showing 1521 ~ 1540 out of 64,152 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:WB-STRAIN:WBStrain00034537

http://www.wormbase.org/db/get?name=WBStrain00034537

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:30254025
Synonyms: unc-119(ed3);hrtEx58[Pida-1::gfp::rab-8; Pgcy-36::mKate2]
Alternate IDs: WB-STRAIN:STR211
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00034537 Copy   


  • RRID:WB-STRAIN:WBStrain00034539

http://www.wormbase.org/db/get?name=WBStrain00034539

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:30254025
Synonyms: unc-116(e2310);hrtSi5[Pdes-2::ebp-2::gfp]
Alternate IDs: WB-STRAIN:STR221
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00034539 Copy   


  • RRID:WB-STRAIN:WBStrain00034531

http://www.wormbase.org/db/get?name=WBStrain00034531

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:30254025
Synonyms: unc-116(rh24sb79);hrtSi19[Pgcy-36::mKate2::rab-3];hrtEx33[Pgcy-36::BFP;ccRFP]
Alternate IDs: WB-STRAIN:STR172
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00034531 Copy   


  • RRID:WB-STRAIN:WBStrain00034532

http://www.wormbase.org/db/get?name=WBStrain00034532

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:30254025, PMID:38548742
Synonyms: hrtSi19[Pgcy-36::mKate2::rab-3];hrtEx33[Pgcy-36::BFP;ccRFP]
Alternate IDs: WB-STRAIN:STR173
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00034532 Copy   


  • RRID:WB-STRAIN:WBStrain00034533

http://www.wormbase.org/db/get?name=WBStrain00034533

Source Database: WormBase (WB)
Availability: available
Source References: PMID:28394337
Synonyms: hrtIs3; hrtEx52.
Alternate IDs: WB-STRAIN:STR198, CGC_STR198
Notes: hrtIs3 [des-2p::myr::GFP + unc-122p::DsRed]. hrtEx52 [des-2p::mKate::GS1(high) + unc-119(+) + myo-2p::tdTomato]. Pick tdTomato+ animals to maintain. Myristylated GFP marker for PVD. PVD development is quite strongly affected by high levels of actin-perturbing DeAct-GS1 expression in PVD and FLP. Phenotype is more severe than that of the low DeAct-GS1 expressing strain STR199, but weaker than that of the DeAct-SpvB expressing strain STR200. Reference: Harterink M, et al. J Cell Sci. 2018 Oct 22;131(20):jcs223107. PMID: 30254025.

Proper citation: RRID:WB-STRAIN:WBStrain00034533 Copy   


  • RRID:WB-STRAIN:WBStrain00034534

http://www.wormbase.org/db/get?name=WBStrain00034534

Source Database: WormBase (WB)
Availability: available
Source References: PMID:28394337
Synonyms: wdIs51; hrtEx53.
Alternate IDs: WB-STRAIN:STR199, CGC_STR199
Notes: wdIs51 [F49H12.4::GFP + unc-119(+)]; likely integrated in X. hrtEx53 [des-2p::mKate::GS1(low) + unc-119(+) + myo-2p::tdTomato]. Pick tdTomato+ animals to maintain. PVD development is somewhat affected by moderate levels of actin-perturbing DeAct-GS1 expression in PVD and FLP. Phenotype is less severe than that of the high DeAct-GS1 expressing strain STR198 and DeAct-SpvB expressing strain STR200. Reference: Harterink M, et al. J Cell Sci. 2018 Oct 22;131(20):jcs223107. PMID: 30254025.

Proper citation: RRID:WB-STRAIN:WBStrain00034534 Copy   


  • RRID:WB-STRAIN:WBStrain00034540

http://www.wormbase.org/db/get?name=WBStrain00034540

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:26906482
Synonyms: unc-119(ed3); hrtEx66[Pwrt-2::mKate2::ePDZ; Pwrt-2::PH::gfp::LOVpep + cb-unc-119(+)]
Alternate IDs: WB-STRAIN:STR222
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00034540 Copy   


  • RRID:WB-STRAIN:WBStrain00034545

http://www.wormbase.org/db/get?name=WBStrain00034545

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:26906482
Synonyms: unc-119(ed3); hrtSi24[Pgcy-36::tomm-20(aa1-41)::mKate2::LOVpep]; hrtEx78[Pgcy-36::unc-116 (aa1-381)::gfp::ePDZ; Pmyo-2::TdTomato]
Alternate IDs: WB-STRAIN:STR254
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00034545 Copy   


  • RRID:WB-STRAIN:WBStrain00034634

http://www.wormbase.org/db/get?name=WBStrain00034634

Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: mjIs11 III; mjIs17 IV.
Alternate IDs: WB-STRAIN:SX333, CGC_SX333
Notes: Made_by: Nicholas Lehrbach|"mjIs11 contains [myo-2::let-7 + unc-119(+)]. mjIs17contains [myo-2::GFP::lin-41 + myo-2::mCherry::unc-54 (let-7 sensor)]."

Proper citation: RRID:WB-STRAIN:WBStrain00034634 Copy   


  • RRID:WB-STRAIN:WBStrain00034635

http://www.wormbase.org/db/get?name=WBStrain00034635

Source Database: WormBase (WB)
Affected Genes: WBGene00003504(mut-7)|WBGene00004010(pha-1)|WBGene00006768(unc-32)
Genomic Alteration: WBGene00003504(mut-7), WBGene00004010(pha-1), WBGene00006768(unc-32)
Availability: available
Source References: EMPTY
Synonyms: unc-32(e189) mut-7(pk204) pha-1(e2123) III; ccEx7271.
Alternate IDs: WB-STRAIN:SX340, CGC_SX340
Notes: ccEx7271 [let-858::GFP + pha-1(+)]. This strain expresses nuclear-localized GFP in all somatic nuclei, but reduced or no GFP in germ cells. If maintained at 20C, pha-1(ts) genotype will select for transgenic animals. Germ cell expression can be observed when maintained at 25C. Germline transgene silencing is abnormal.

Proper citation: RRID:WB-STRAIN:WBStrain00034635 Copy   


  • RRID:WB-STRAIN:WBStrain00034630

http://www.wormbase.org/db/get?name=WBStrain00034630

Source Database: WormBase (WB)
Affected Genes: WBGene00004178(prg-1)|WBGene00004179(prg-2)|WBGene00006759(unc-22)
Genomic Alteration: WBGene00004178(prg-1), WBGene00004179(prg-2), WBGene00006759(unc-22)
Availability: available
Source References: EMPTY
Synonyms: prg-1(n4357) I; prg-2(n4358) unc-22(st136) IV.
Alternate IDs: WB-STRAIN:SX166, CGC_SX166
Notes: Mutagen:EMS(n4357 & n4358) Curator_confirmed WBPerson1983|"Transposon silencing normal."

Proper citation: RRID:WB-STRAIN:WBStrain00034630 Copy   


  • RRID:WB-STRAIN:WBStrain00034631

http://www.wormbase.org/db/get?name=WBStrain00034631

Source Database: WormBase (WB)
Affected Genes: WBGene00004178(prg-1)|WBGene00006759(unc-22)
Genomic Alteration: WBGene00004178(prg-1), WBGene00006759(unc-22)
Availability: available
Source References: EMPTY
Synonyms: prg-1(n4357) I; unc-22(r765) IV.
Alternate IDs: WB-STRAIN:SX178, CGC_SX178
Notes: Mutagen:EMS/Tc4|"Twitching due to transposon insertion in unc-22."

Proper citation: RRID:WB-STRAIN:WBStrain00034631 Copy   


  • RRID:WB-STRAIN:WBStrain00034633

http://www.wormbase.org/db/get?name=WBStrain00034633

Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: mjIs17 IV.
Alternate IDs: WB-STRAIN:SX328, CGC_SX328
Notes: Made_by: Nicholas Lehrbach|"mjIs17 contains [myo-2::GFP::lin-41 + myo-2::mCherry::unc-54 (let-7 sensor)]."|"mjIs17contains [myo-2::GFP::lin-41 + myo-2::mCherry:unc-54 (let-7 sensor)]."

Proper citation: RRID:WB-STRAIN:WBStrain00034633 Copy   


  • RRID:WB-STRAIN:WBStrain00034646

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00034646

Source Database: WormBase (WB)
Affected Genes: WBGene00008995(prde-1)
Genomic Alteration: WBGene00008995(prde-1)
Availability: available
Source References: EMPTY
Synonyms: prde-1(mj207) V.
Alternate IDs: WB-STRAIN:SX2499, CGC_SX2499
Notes: piRNA biogenesis mutant. Reduced brood size. Maintain at 20C. Reference: Weick EM, et al. Genes Dev. 2014 Apr 1;28(7):783-96.

Proper citation: RRID:WB-STRAIN:WBStrain00034646 Copy   


  • RRID:WB-STRAIN:WBStrain00034642

http://www.wormbase.org/db/get?name=WBStrain00034642

Source Database: WormBase (WB)
Affected Genes: WBGene00004178(prg-1)
Genomic Alteration: WBGene00004178(prg-1)
Availability: available
Source References: PMID:31402283, PMID:33086057
Synonyms: prg-1(n4357) I.
Alternate IDs: WB-STRAIN:SX922, CGC_SX922
Notes: 21U RNA expression abnormal. Temperature sensitive sterility. Transposon silencing abnormal. Superficially WT. Deletion breakpoints: GTTTTCTTTCCTTGGAGAGGT|"no longer available from the CGC."

Proper citation: RRID:WB-STRAIN:WBStrain00034642 Copy   


  • RRID:WB-STRAIN:WBStrain00034612

http://www.wormbase.org/db/get?name=WBStrain00034612

Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: unc-119(ed3) III; heIs105 IV.
Alternate IDs: WB-STRAIN:SV1361, CGC_SV1361
Notes: heIs105 [rps-27::loxP::NLS::mCherry::let858 UTR::loxP::NLS::GFP::let-858 UTR + unc-119(+)] IV. Strain is viable at 15-25 C. heIs105 carries a read-out construct which allows the visualization of the CRE lox mediated recombination by a switch from red to green. Reference: Ruijtenberg S & van den Heuvel S. Cell. 2015 Jul 16;162(2):300-13.

Proper citation: RRID:WB-STRAIN:WBStrain00034612 Copy   


  • RRID:WB-STRAIN:WBStrain00034613

http://www.wormbase.org/db/get?name=WBStrain00034613

Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: unc-119(ed3) III; heSi141 X.
Alternate IDs: WB-STRAIN:SV1438, CGC_SV1438
Notes: heSi141 [hlh-8(short)::FLAG::CRE::tbb-2 + unc-119(+)] X. Strain is viable at 15-25 C, but non-tissue specific recombination is observed more frequently in other tissues at higher temperatures (25C). Expression of CRE recombinase in the mesoblast lineage driven by the hlh-8 promoter. Reference: Ruijtenberg S & van den Heuvel S. Cell. 2015 Jul 16;162(2):300-13.

Proper citation: RRID:WB-STRAIN:WBStrain00034613 Copy   


  • RRID:WB-STRAIN:WBStrain00034614

http://www.wormbase.org/db/get?name=WBStrain00034614

Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: unc-119(ed3) III; heSi142 X.
Alternate IDs: WB-STRAIN:SV1439, CGC_SV1439
Notes: heSi142 [elt-2::FLAG::CRE::tbb-2 + unc-119(+)] X. Expression of CRE recombinase in the intestine driven by the elt-2 promoter. Strain is viable at 15-25 C, but non-tissue specific recombination is observed more frequently in other tissues at higher temperatures (25C). Reference: Ruijtenberg S & van den Heuvel S. Cell. 2015 Jul 16;162(2):300-13.

Proper citation: RRID:WB-STRAIN:WBStrain00034614 Copy   


  • RRID:WB-STRAIN:WBStrain00034617

http://www.wormbase.org/db/get?name=WBStrain00034617

Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: unc-119(ed3) III; heIs145 IV
Alternate IDs: WB-STRAIN:SV1450, CGC_SV1450
Notes: heIs145 [rps-27::loxP::NLS::mCherry::let858 UTR::eft-3::tagBFP::tbb-2 UTR::loxP::NLS::GFP::let-858 UTR + unc-119(+)] IV. Maintain at 15-25C. heIs145 expresses a read-out construct used to visualize CRE activity and specificity, and to test whether CRE expression is likely to induce loss of a gene of interest (tagBFP in this case) in a given tissue. Expression of CRE will result in a change from mCherry to GFP and loss of tagBFP expression in those cells where CRE is active. Reference: Ruijtenberg S & van den Heuvel S. Cell. 2015 Jul 16;162(2):300-13.

Proper citation: RRID:WB-STRAIN:WBStrain00034617 Copy   


  • RRID:WB-STRAIN:WBStrain00034618

http://www.wormbase.org/db/get?name=WBStrain00034618

Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: unknown
Source References: EMPTY
Synonyms: unc-119(ed3) III; heSi148 X.
Alternate IDs: WB-STRAIN:SV1461
Notes: heSi148 [myo-3::CRE::tbb-2 UTR + unc-119(+)] X. Inserted at ttTi14024. Maintain at 15-25C. Expression of CRE recombinase in differentiated body wall muscle cells driven by the myo-3 promoter. Reference: Ruijtenberg S & van den Heuvel S. Cell. 2015 Jul 16;162(2):300-13.|"No longer available from the CGC"

Proper citation: RRID:WB-STRAIN:WBStrain00034618 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X