Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=616572805
Source Database: Rat Genome Database (RGD)
Genetic Background: recombinant_inbred
Availability: Unknown
Alternate IDs: 616572805
Notes: Embryo-rederived from breeder stock HXB5/Ipcv provided by Pravenec and Kren from the Prague colonies, maintained at Medical college of Wisconsin. RGD HRDP, contact Hybrid Rat Diversity Panel at
[email protected]
Proper citation: RRID:RGD_616572805 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=625777900
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Embryo (as of 2025-08-06)
Alternate IDs: 625777900
Notes: Ugt2 (cluster) KO strain: The Ugt2 cluster was disrupted using the genome editing technology CRISPR/Cas9, and F1 rats (heterozygotes) were produced by crossing with Wistar (Crlj:WI) rats. The F1 rats were then crossed with each other to produce a homozygous strain. Ugt2 KO map Tc (UGT2-MAC) strain (Tc: transchromosomic): After introducing UGT2-MAC into rat ES cells (BLK2i-1), chimera rats were produced, which were then crossed with Wistar rats to produce F1 transmission rats, and further crossed with Wistar rats for several generations to produce strain rats. The MAC vector consists of the following genes: HPRT gene full length sequence, bovine growth hormone (BGH) polyA signal, b-actin promoter, b-globin insulator, CMV-IE enhancer, SV40 polyA signal, loxP sequence, FRT sequence, ampicillin resistance gene, neomycin resistance gene, kanamycin resistance gene, puromycin resistance gene, green fluorescent protein (GFP) gene and its mutants, PGK promoter, mouse chromosome 11 centromere region Tc (UGT2-MAC)-UGT2 strain: The strain was created by crossing the Tc(UGT2-MAC) strain with the Ugt2 (cluster) KO strain. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_625777900 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=19165364
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals (as of 2026-03-05)
Alternate IDs: 19165364
Notes: Cas9 protein and sgRNA targeting the sequence CCTTTTTGCAGAGCACGAAA within exon 2 of Adcy3 were injected into embryos of the WKY/NCrl strain. A 3-bp deletion resulted (rn7: chr6:27,126,062-27,126,064). Contact Dr. Solberg-Woods at Wake Forest University School of Medicine, Email: [email protected]
Proper citation: RRID:RGD_19165364 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=632518377
Source Database: Rat Genome Database (RGD)
Genetic Background: outbred
Availability: Live Animals (as of 2026-02-10)
Alternate IDs: 632518377
Notes: Shjh outbred SD rats were first obtained in 2017 from the NIH Animal Genetic Resource. The NIH stock originated from Sprague Dawley, Inc. in 1945 and has since been maintained as an outbred closed colony. Shanghai Jihui Laboratory Animal Breeding Co., Ltd
Proper citation: RRID:RGD_632518377 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=632522749
Source Database: Rat Genome Database (RGD)
Genetic Background: transgenic
Availability: Unknown
Alternate IDs: 632522749
Notes: This transgenic rat strain carrying human NR3C2 was developed on a Sprague-Dawley albino background. The transgene was constructed with the human NR3C2 (also know as MR) under the proximal P1 promotor in the 5′-flanking regions of exons 1alpha.
Proper citation: RRID:RGD_632522749 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=625776931
Source Database: Rat Genome Database (RGD)
Genetic Background: transchromosomal
Availability: Unknown
Alternate IDs: 625776931
Notes: Chimeric rats were generated using rBLK2i-1 (WDB/Nips-ES1/Nips, RGD: 10054010) to which human CYP3A cluster (4 coding genes: CYP3A4, CYP3A5, CYP3A7, and CYP3A43) was introduced. ES cells carrying the CYP3A chromosomal DNA were microinjected into the blastocoel cavity of Crlj:wi E4.5 blastocysts. Chromosome Engineering Research Center, Tottori University, Yonago, 683-8503 Tottori, Japan
Proper citation: RRID:RGD_625776931 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=625776930
Source Database: Rat Genome Database (RGD)
Genetic Background: transchromosomal
Availability: Unknown
Alternate IDs: 625776930
Notes: Chimeric rats were generated using rBLK2i-1 (WDB/Nips-ES1/Nips, RGD: 10054010) to which human UGT2 cluster (10 coding genes: UGT2B4, UGT2B7, UGT2B10, UGT2B11, UGT2B15, UGT2B17, UGT2B28, UGT2A1, UGT2A2, and UGT2A3) was introduced. ES cells carrying the UGT2 chromosomal DNA were microinjected into the blastocoel cavity of Crlj:wi E4.5 blastocysts. Chromosome Engineering Research Center, Tottori University, Yonago, 683-8503 Tottori, Japan
Proper citation: RRID:RGD_625776930 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=1302691
Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Live Animals; Cryopreserved Embryo
Alternate IDs: 1302691
Notes: Albany, N.Y.(Wolf)?N(Jay)to Hokkaido University, Faculty of Science(Mk)to National Institute of Genetics(Ms) 1958?Hokkaido University, Laboratory of Experimental Animal Science(Hok) 1975, F48 to Hokkaido University, Center for Experimental Plants & Animals(Hok) National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_1302691 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=631846
Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 631846
Notes: Congenic strain originated from an inbred F344/Mcwi strain
Proper citation: RRID:RGD_631846 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=1302692
Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Cryopreserved Embryo
Alternate IDs: 1302692
Notes: The desired fragment is transferred from SHRSP to WKY. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_1302692 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=631160
Source Database: Rat Genome Database (RGD)
Genetic Background: recombinant_inbred
Availability: Unknown
Alternate IDs: 631160
Notes: Is a recombinant inbred strain produced from a cross between DA/Han and E3/Han rats
Proper citation: RRID:RGD_631160 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=631577
Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Live Animals
Alternate IDs: 631577
Notes: Strain originated in 1963 from outbred Wistar Kyoto rats. Bred from a male with mild hypertension, mated with a female with high blood pressure. Brother x sister mating with continued selection for high blood pressure (Okamoto 1969, Okamoto et al 1972). National BioResource Project for the Rat in Japan, Funabashi Farm, Chiba, Japan
Proper citation: RRID:RGD_631577 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=1304487
Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Unknown
Alternate IDs: 1304487
Notes: Diabetic resistant BB rats. These are derived from a viral antibody free (VAF)colony which was maintained at University of Massachusetts and is now at BRM. In 1977, Butler et al. began inbreeding BB rats at the University of Massachusetts Medical Center (laboratory code Wor) with 300 breeders purchased from the Bio-Breeding Laboratories. In 1978, during inbreding, pathogen-free rodent barrier system was introduced and a strain disease resistant (DR) by was established by selective breeding of diabtes free progenies.
Proper citation: RRID:RGD_1304487 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=631219
Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Live Animals (as of 2021-04-23)
Alternate IDs: 631219
Notes: Established from an outbred colony of Sprague-Dawley (purchased from Charles River Japan) in Torii Pharmaceutical Co. Ltd. This company was merged to CLEA Japan Inc. in 1998. This substrain was established in 1997. Rats with polyuria and glucosuria were bred for 20 generations of brother-sister mating. CLEA Japan, Inc
Proper citation: RRID:RGD_631219 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=1302699
Source Database: Rat Genome Database (RGD)
Genetic Background: recombinant_inbred
Availability: Cryopreserved Embryo
Alternate IDs: 1302699
Notes: This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_1302699 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=1302696
Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Live Animals (as of 2024-09-24)
Alternate IDs: 1302696
Notes: Strain originated at Japan SLC, Inc., Shizuoka , Japan. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_1302696 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=631695
Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Unknown
Alternate IDs: 631695
Notes: This inbred strain was derived from the inbred SS/Jr strain available from Harlan Sprague-Dawley (Indianapolis, Ind, US). The colony was established in 1997 at the Freie Universitat Berlin
Proper citation: RRID:RGD_631695 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=631574
Source Database: Rat Genome Database (RGD)
Genetic Background: wild
Availability: Unknown
Alternate IDs: 631574
Notes: Wild rats were captured in Rostock, Greifswald, in an industrial pig farm near Greifswald and some in a farm near Munich in Germany.
Proper citation: RRID:RGD_631574 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=1331832
Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 1331832
Notes: This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with BN males to transfer the desired locus to BN background.
Proper citation: RRID:RGD_1331832 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=737962
Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Unknown
Alternate IDs: 737962
Notes: Substrain of SPRD, from outbred Sprague-Dawley rats at the Hannover facility, where inbreeding began in 1976
Proper citation: RRID:RGD_737962 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
