Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
WKY-Col4a5em3Matsu Resource Report Resource Website |
RRID:RGD_329845600 | Rattus norvegicus | Genome editing was performed using the rGONAD method to produce three different lines of KO rats due to three different genome mutations thus different in protein expression predication. The genetic background is WKY/NCrlCrlj (Charles River Laboratories Japan) (RGD:61119). Tandem STOP codons were designed to integrate into 27 bases after the first ATG in the rat Col4a5 gene This em3 mutant carries a deletion of 56 base pairs containing the first methioine. Col4α5 em3 ratshave urinary protein and hematuria from early on, and males begin to die at 18 weeks of age and all die by 28 weeks of age. National BioResource Project for the Rat in Japan | 329845600 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 329845600 | 2026-08-29 11:50:00 | 0 | |||||
|
LEW-Chrna3em1Mcwi Resource Report Resource Website |
RRID:RGD_10054373 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the Chrna3 gene of LEW/NCrl rat embryos.The resulting mutation is a 1-bp (G) insertion in the Chrna3 gene. Contact MCW rat distribution at [email protected] | 10054373 | mutant | Rat Genome Database (RGD) | RGD | Unknown (as of 2018-10-22) | 10054373 | 2026-08-29 11:50:00 | 0 | |||||
|
SD-Pde3aem3Bdr Resource Report Resource Website |
RRID:RGD_155631298 | Rattus norvegicus | The rat mutant was generated by pronuclear microinjection of Sprague-Dawley rat zygotes with a mixture of Cas9/Cas9 system to target the catalytic domain in the rat Pde3a gene. The model has a carriesa CGT to TGD missense mutation and results in R862C substitutions in the protein | 155631298 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 155631298 | 2026-08-29 11:49:59 | 0 | |||||
|
SD-Ahrem1Iexas+/- Resource Report Resource Website |
RRID:RGD_401940197 | Rattus norvegicus | The Ahr heterozygous rats were created using CRISPR/Cas9 gene editing to delete 10 bp of exon 2 of Ahr in Sprague Dawley rats . | 401940197 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 401940197 | 2026-08-29 11:50:00 | 0 | |||||
|
SS-Xdhem1Mcwi+/- Resource Report Resource Website |
RRID:RGD_405849408 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a 7-bp deletion in exon 4 of rat Xdh gene in the SS/JrHsdMcwi embryos. This is a heterozygous strain which has decreased Xdh protein detected in the kidney cortex tissue as compared to the wild type littermate at 6-week old. Contact MCW rat distribution at [email protected] | 405849408 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 405849408 | 2026-08-29 11:50:00 | 0 | |||||
|
SD-Mpoem1Mcwi Resource Report Resource Website |
RRID:RGD_401717572 | Rattus norvegicus | CRISPR/SpCas9 system using sgRNA targeting the sequence CAGGGCCACGTGCAGATAGTCGG was used to introduce an 11-bp deletion (rn7: chr10:72,595,923-72,595,933) in exon 4 of the Mpo gene in Crl:SD strain rats. | 401717572 | mutant | Rat Genome Database (RGD) | RGD | Live Animals (as of 2023-08-07) | 401717572 | 2026-08-29 11:50:00 | 0 | |||||
|
CD-Ctnsem4Vjupk Resource Report Resource Website |
RRID:RGD_155630635 | Rattus norvegicus | The mutant rat was produced by injecting Crl:CD(SD) zygotes with gRNA +Cas9 ribonucleoprotein complex targeting exon 3 of rat Ctns. The founder of this strain possessed a 7-bp deletion which results in frameshift and pre-mature stop truncated protein. | 155630635 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 155630635 | 2026-08-29 11:49:59 | 0 | |||||
|
WN Resource Report Resource Website |
RRID:RGD_70458 | Rattus norvegicus | Heston in 1942 from Wistar stock of Nettleship, This WN is the parent to WN substrains maintained in other institutions. | 70458 | inbred | Rat Genome Database (RGD) | RGD | Unknown | 70458 | 2026-08-29 11:50:00 | 0 | |||||
|
SD-Ahrem1Iexas-/- Resource Report Resource Website |
RRID:RGD_401940195 | Rattus norvegicus | The homozygous knockout rats were created using CRISPR/Cas9 gene editing to delete 10 bp of exon 2 of Ahr in Sprague Dawley rats . | 401940195 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 401940195 | 2026-08-29 11:50:00 | 0 | |||||
|
SS-Mmp2em1Mcwi+/+ Resource Report Resource Website |
RRID:RGD_5688032 | Rattus norvegicus | ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. | (null) | (null) | 5688032 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 5688032 | 2026-08-29 11:50:00 | 0 | |||
|
SD-Gcdhem1Dba Resource Report Resource Website |
RRID:RGD_10759544 | Rattus norvegicus | this strain was produced by CRISPR/Cas9 system. The resulting knock-in mutation is R411W in exon 11 of the GCDH gene. | 10759544 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 10759544 | 2026-08-29 11:50:00 | 0 | |||||
|
ZSF1-Leprfa/cp/Crl Resource Report Resource Website |
RRID:RGD_401960101 | Rattus norvegicus | This F1 obese model was developed by crossing rat strains with two separate leptin receptor mutations (fa and facp), In Charles River, they mate a Heterozygous ZDF (fa/+) with a Homozygous SHHF (cp/cp).This mating of ZDF and SHHF parent can produce obese ZSF1 (having fa and cp mutation from both parents) or lean ZSF1 (having just one copy of mutated Lepr, either cp or fa). The obese F1 develop insulin resistance, hyperglycaemia, and mild hypertension Charles River Laboratories | 401960101 | hybrid | Rat Genome Database (RGD) | RGD | Unknown | 401960101 | 2026-08-29 11:50:00 | 0 | |||||
|
SD-Tg(Myh6-cre)Lizh Resource Report Resource Website |
RRID:RGD_329969882 | Rattus norvegicus | The heart-specific cre expression plasmid (alpha-MHC-Cre) was produced by inserting the cre coding sequence downstream of the a-MHC (Mgh6) promoter in the a-MHC expression vector. The a-MHC-Cre transgenic rat was generated by microinjection of linearized alpha-MHC-Cre plasmid to Sprague Dawley embryos. | 329969882 | transgenic | Rat Genome Database (RGD) | RGD | Unknown | 329969882 | 2026-08-29 11:49:59 | 0 | |||||
|
SD-Trim44em1Lizh Resource Report Resource Website |
RRID:RGD_329969883 | Rattus norvegicus | A pair of synthetic oligonucleotides for sgRNA (sgRNA1, CCTTGCCGCTTTAAGTGACTC; sgRNA2, CCATGTTGGGAGCATTGCCTA) were annealed and then cloned into the pUC57-sgRNA expression vector, and the floxed plasmid donor was cloned into the pGSI plasmid. Both the Cas9 and sgRNA expression plasmids were linearized and used as templates for in vitro transcription. A mixture of the donor vector (4ââ¬â¦ng/ul), Cas9 mRNA (25ââ¬â¦ng/ul), and sgRNAs (10ââ¬â¦ng/ul each) was microinjected into both the cytoplasm and male pronucleus of the fertilized eggs. The injected zygotes were then transferred to pseudopregnant SD rats, which then carried them to parturition. This is called conditional knockout Trim44 (Trim44 cKO). | 329969883 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 329969883 | 2026-08-29 11:50:00 | 0 | |||||
|
SD-Fahem3McwiIl2rgem2McwiRag1em6Mcwi Resource Report Resource Website |
RRID:RGD_401824639 | Rattus norvegicus | Produced by injection of CRISPR/Cas9 targeting the genomic sequence GGTGAGATCCTTTGAAAAGG in Rag1 into double homozygous embryos with knockout of Fah and Il2rg produced following multiple generations of intercrossing strains SD-Il2rgem2Mcwi (RGDID:10002794) and SD-Fahem3Mcw (RGDID: 10002791). The resulting CRISPR-induced mutation in Rag1 deletes 25-bp (rn7: chr3:87,923,384-87,923,408) and inserts 17 bp (ACCCTAAACAGCTGTGC) for a net 8-bp deletion. availability contact: [email protected] | 401824639 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2025-11-22) | 401824639 | 2026-08-29 11:50:00 | 0 | |||||
|
WIC;WDB-Kiss1tm1Nurep Resource Report Resource Website |
RRID:RGD_329848995 | Rattus norvegicus | The kisspeptin gene (Kiss1) is knocked out conditonally by the Cre recombinase. This strain was generated by K.I. Maeda (The University of Tokyo), H. Tsukamura, Y. Uenoyama, N. Inoue (Nagoya University), and M. Hirabayashi (National Institute for Physiological Sciences) for the purpose of producing conditional knockout rats of the Kiss1 gene in the hypothalamus. The targeting vector (loxP, Kiss1[exons 2 and 3], PGK promoter-neo, loxP) was introduced by electroporation targeting the Kiss1 gene in ES cells (WDB/Nips-ES1/Nips). Crossed with and maintained by the Wistar-Imamichi rats (Iar:Wistar-Imamichi, Institute for Animal Reproduction). National BioResource Project for the Rat in Japan | 329848995 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2023-06-07) | 329848995 | 2026-08-29 11:50:00 | 0 | |||||
|
LE-Tg(Drd2-cre)487-3Koba Resource Report Resource Website |
RRID:RGD_329848998 | Rattus norvegicus | This strain is established by injection of modified BAC (cre gene was inserted into the exon 2 of rat Drd2 gene) into Long-Evans rat's fertile eggs. Detailed information of BAC: Drd2, CH230-11B15 from the CHORI-230 Female Brown Norway rat BAC Library (BACPAC Resources Center, Children?s Hospital Oakland Research Institute)" National BioResource Project for the Rat in Japan | 329848998 | transgenic | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2023-06-07) | 329848998 | 2026-08-29 11:50:00 | 0 | |||||
|
WIC.WDB-Kiss1tm1(tdTomato)Nurep Resource Report Resource Website |
RRID:RGD_329848994 | Rattus norvegicus | Kiss1 knockout rats were generated by K.I. Maeda (The University of Tokyo), H. Tsukamura, Y. Uenoyama, N. Inoue (Nagoya University), and M. Hirabayashi (National Institute for Physiological Sciences). The targeting vector (tdTomato/puromycin N-acetyl transferase) was introduced by electroporation targeting the Kiss1 gene in ES cells (WDB/Nips-ES1/Nips). Crossed with and maintained by the Wistar-Imamichi rats (Iar:Wistar-Imamichi, Institute for Animal Reproduction). National BioResource Project for the Rat in Japan | 329848994 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2023-06-21) | 329848994 | 2026-08-29 11:50:00 | 0 | |||||
|
CD-Slc30a10em1Sommu Resource Report Resource Website |
RRID:RGD_401795484 | Rattus norvegicus | Exon 1 of Slc30a10 was targeted using CRISPR/Cas9 in the Crl:CD(SD) embryos . A mosiac founder that transmitted a 248 bp deletion in exon 1 of Slc30a10 leading to an out of frame mutation after amino acid 22 was bred to a CD rat to select for the above deletion and establish the line. The strain will be deposited to RRRC. | 401795484 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2023-09-11) | 401795484 | 2026-08-29 11:50:00 | 0 | |||||
|
SD.SD-Fahem3McwiIl2rgem2McwiRag1em6Mcwi/Mcwi Resource Report Resource Website |
RRID:RGD_401824640 | Rattus norvegicus | This model was made by taking RGD:401824639 (Fah, Il2rg, and Rag1 triple knockout model) and backcrossing to Crl:SD, then intercrossing multiple generations again until all three gene alleles were homozygous again. Availability contact: [email protected] | 401824640 | congenic | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2023-09-18) | 401824640 | 2026-08-29 11:50:00 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
