Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

On page 70 showing 1381 ~ 1400 out of 4,651 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:RGD_329845600

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=329845600

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 329845600
Notes: Genome editing was performed using the rGONAD method to produce three different lines of KO rats due to three different genome mutations thus different in protein expression predication. The genetic background is WKY/NCrlCrlj (Charles River Laboratories Japan) (RGD:61119). Tandem STOP codons were designed to integrate into 27 bases after the first ATG in the rat Col4a5 gene This em3 mutant carries a deletion of 56 base pairs containing the first methioine. Col4α5 em3 ratshave urinary protein and hematuria from early on, and males begin to die at 18 weeks of age and all die by 28 weeks of age. National BioResource Project for the Rat in Japan

Proper citation: RRID:RGD_329845600 Copy   


  • RRID:RGD_10054373

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10054373

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown (as of 2018-10-22)
Alternate IDs: 10054373
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Chrna3 gene of LEW/NCrl rat embryos.The resulting mutation is a 1-bp (G) insertion in the Chrna3 gene. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_10054373 Copy   


  • RRID:RGD_155631298

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=155631298

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 155631298
Notes: The rat mutant was generated by pronuclear microinjection of Sprague-Dawley rat zygotes with a mixture of Cas9/Cas9 system to target the catalytic domain in the rat Pde3a gene. The model has a carriesa CGT to TGD missense mutation and results in R862C substitutions in the protein

Proper citation: RRID:RGD_155631298 Copy   


  • RRID:RGD_401940197

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=401940197

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 401940197
Notes: The Ahr heterozygous rats were created using CRISPR/Cas9 gene editing to delete 10 bp of exon 2 of Ahr in Sprague Dawley rats .

Proper citation: RRID:RGD_401940197 Copy   


  • RRID:RGD_405849408

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=405849408

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 405849408
Notes: CRISPR/Cas9 system was used to introduce a 7-bp deletion in exon 4 of rat Xdh gene in the SS/JrHsdMcwi embryos. This is a heterozygous strain which has decreased Xdh protein detected in the kidney cortex tissue as compared to the wild type littermate at 6-week old. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_405849408 Copy   


  • RRID:RGD_401717572

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=401717572

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals (as of 2023-08-07)
Alternate IDs: 401717572
Notes: CRISPR/SpCas9 system using sgRNA targeting the sequence CAGGGCCACGTGCAGATAGTCGG was used to introduce an 11-bp deletion (rn7: chr10:72,595,923-72,595,933) in exon 4 of the Mpo gene in Crl:SD strain rats.

Proper citation: RRID:RGD_401717572 Copy   


  • RRID:RGD_155630635

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=155630635

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 155630635
Notes: The mutant rat was produced by injecting Crl:CD(SD) zygotes with gRNA +Cas9 ribonucleoprotein complex targeting exon 3 of rat Ctns. The founder of this strain possessed a 7-bp deletion which results in frameshift and pre-mature stop truncated protein.

Proper citation: RRID:RGD_155630635 Copy   


  • RRID:RGD_70458

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=70458

Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Unknown
Alternate IDs: 70458
Notes: Heston in 1942 from Wistar stock of Nettleship, This WN is the parent to WN substrains maintained in other institutions.

Proper citation: RRID:RGD_70458 Copy   


  • RRID:RGD_401940195

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=401940195

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 401940195
Notes: The homozygous knockout rats were created using CRISPR/Cas9 gene editing to delete 10 bp of exon 2 of Ahr in Sprague Dawley rats .

Proper citation: RRID:RGD_401940195 Copy   


  • RRID:RGD_5688032

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5688032

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Genomic Alteration: (null)
Availability: Unknown
Source References: (null)
Alternate IDs: 5688032
Notes: ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.

Proper citation: RRID:RGD_5688032 Copy   


  • RRID:RGD_10759544

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10759544

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 10759544
Notes: this strain was produced by CRISPR/Cas9 system. The resulting knock-in mutation is R411W in exon 11 of the GCDH gene.

Proper citation: RRID:RGD_10759544 Copy   


  • RRID:RGD_401960101

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=401960101

Source Database: Rat Genome Database (RGD)
Genetic Background: hybrid
Availability: Unknown
Alternate IDs: 401960101
Notes: This F1 obese model was developed by crossing rat strains with two separate leptin receptor mutations (fa and facp), In Charles River, they mate a Heterozygous ZDF (fa/+) with a Homozygous SHHF (cp/cp).This mating of ZDF and SHHF parent can produce obese ZSF1 (having fa and cp mutation from both parents) or lean ZSF1 (having just one copy of mutated Lepr, either cp or fa). The obese F1 develop insulin resistance, hyperglycaemia, and mild hypertension Charles River Laboratories

Proper citation: RRID:RGD_401960101 Copy   


  • RRID:RGD_329969882

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=329969882

Source Database: Rat Genome Database (RGD)
Genetic Background: transgenic
Availability: Unknown
Alternate IDs: 329969882
Notes: The heart-specific cre expression plasmid (alpha-MHC-Cre) was produced by inserting the cre coding sequence downstream of the a-MHC (Mgh6) promoter in the a-MHC expression vector. The a-MHC-Cre transgenic rat was generated by microinjection of linearized alpha-MHC-Cre plasmid to Sprague Dawley embryos.

Proper citation: RRID:RGD_329969882 Copy   


  • RRID:RGD_329969883

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=329969883

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 329969883
Notes: A pair of synthetic oligonucleotides for sgRNA (sgRNA1, CCTTGCCGCTTTAAGTGACTC; sgRNA2, CCATGTTGGGAGCATTGCCTA) were annealed and then cloned into the pUC57-sgRNA expression vector, and the floxed plasmid donor was cloned into the pGSI plasmid. Both the Cas9 and sgRNA expression plasmids were linearized and used as templates for in vitro transcription. A mixture of the donor vector (4 ng/ul), Cas9 mRNA (25 ng/ul), and sgRNAs (10 ng/ul each) was microinjected into both the cytoplasm and male pronucleus of the fertilized eggs. The injected zygotes were then transferred to pseudopregnant SD rats, which then carried them to parturition. This is called conditional knockout Trim44 (Trim44 cKO).

Proper citation: RRID:RGD_329969883 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=401824639

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2025-11-22)
Alternate IDs: 401824639
Notes: Produced by injection of CRISPR/Cas9 targeting the genomic sequence GGTGAGATCCTTTGAAAAGG in Rag1 into double homozygous embryos with knockout of Fah and Il2rg produced following multiple generations of intercrossing strains SD-Il2rgem2Mcwi (RGDID:10002794) and SD-Fahem3Mcw (RGDID: 10002791). The resulting CRISPR-induced mutation in Rag1 deletes 25-bp (rn7: chr3:87,923,384-87,923,408) and inserts 17 bp (ACCCTAAACAGCTGTGC) for a net 8-bp deletion. availability contact: [email protected]

Proper citation: RRID:RGD_401824639 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=329848995

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2023-06-07)
Alternate IDs: 329848995
Notes: The kisspeptin gene (Kiss1) is knocked out conditonally by the Cre recombinase. This strain was generated by K.I. Maeda (The University of Tokyo), H. Tsukamura, Y. Uenoyama, N. Inoue (Nagoya University), and M. Hirabayashi (National Institute for Physiological Sciences) for the purpose of producing conditional knockout rats of the Kiss1 gene in the hypothalamus. The targeting vector (loxP, Kiss1[exons 2 and 3], PGK promoter-neo, loxP) was introduced by electroporation targeting the Kiss1 gene in ES cells (WDB/Nips-ES1/Nips). Crossed with and maintained by the Wistar-Imamichi rats (Iar:Wistar-Imamichi, Institute for Animal Reproduction). National BioResource Project for the Rat in Japan

Proper citation: RRID:RGD_329848995 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=329848998

Source Database: Rat Genome Database (RGD)
Genetic Background: transgenic
Availability: Cryopreserved Sperm (as of 2023-06-07)
Alternate IDs: 329848998
Notes: This strain is established by injection of modified BAC (cre gene was inserted into the exon 2 of rat Drd2 gene) into Long-Evans rat's fertile eggs. Detailed information of BAC: Drd2, CH230-11B15 from the CHORI-230 Female Brown Norway rat BAC Library (BACPAC Resources Center, Children?s Hospital Oakland Research Institute)" National BioResource Project for the Rat in Japan

Proper citation: RRID:RGD_329848998 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=329848994

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2023-06-21)
Alternate IDs: 329848994
Notes: Kiss1 knockout rats were generated by K.I. Maeda (The University of Tokyo), H. Tsukamura, Y. Uenoyama, N. Inoue (Nagoya University), and M. Hirabayashi (National Institute for Physiological Sciences). The targeting vector (tdTomato/puromycin N-acetyl transferase) was introduced by electroporation targeting the Kiss1 gene in ES cells (WDB/Nips-ES1/Nips). Crossed with and maintained by the Wistar-Imamichi rats (Iar:Wistar-Imamichi, Institute for Animal Reproduction). National BioResource Project for the Rat in Japan

Proper citation: RRID:RGD_329848994 Copy   


  • RRID:RGD_401795484

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=401795484

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2023-09-11)
Alternate IDs: 401795484
Notes: Exon 1 of Slc30a10 was targeted using CRISPR/Cas9 in the Crl:CD(SD) embryos . A mosiac founder that transmitted a 248 bp deletion in exon 1 of Slc30a10 leading to an out of frame mutation after amino acid 22 was bred to a CD rat to select for the above deletion and establish the line. The strain will be deposited to RRRC.

Proper citation: RRID:RGD_401795484 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=401824640

Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Cryopreserved Sperm (as of 2023-09-18)
Alternate IDs: 401824640
Notes: This model was made by taking RGD:401824639 (Fah, Il2rg, and Rag1 triple knockout model) and backcrossing to Crl:SD, then intercrossing multiple generations again until all three gene alleles were homozygous again. Availability contact: [email protected]

Proper citation: RRID:RGD_401824640 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X