Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
SHRSP/NgskMeltw Resource Report Resource Website |
RRID:RGD_155782877 | Rattus norvegicus | Imported from Kyoto University in 2010, now maintained at Molecular Embryological & DNA Methylation Lab at National Chung Hsing University, Taiwan. | 155782877 | inbred | Rat Genome Database (RGD) | RGD | Live Animals (as of 2022-12-07) | 155782877 | 2026-08-29 11:49:59 | 0 | |||||
|
MNS/NMcwi Resource Report Resource Website |
RRID:RGD_156420139 | Rattus norvegicus | These are re-derived rats of MNS/N now maintained at Medical College of Wisconsin. Origin: Wistar rats with brother x sister mating and selection for low systolic blood pressure as a normotensive control for MHS. RGD HRDP, contact Hybrid Rat Diversity Program at [email protected] | 156420139 | inbred | Rat Genome Database (RGD) | RGD | Live Animals; Cryopreserved Embryo (as of 2024-08-06) | 156420139 | 2026-08-29 11:49:58 | 0 | |||||
|
F344-Txn1m1Kyo Resource Report Resource Website |
RRID:RGD_288084580 | Rattus norvegicus | This mutation Phe54Leu is an autosomal dominant mutation that appeared in a stock of F344/NSlc rats that had been mutagenized with N-ethyl-N-nitrosourea (ENU). Rats heterozygous for Txn1 (Txn1 /+) exhibited running seizures only in its juvenile stage. The rat called Adem rat, exhibited age dependent mitochondrial cytopathy (Adem). The rats were backcrossed for more than ten generations on the F344/NSlc inbred background to ensure other mutations induced by ENU was reduced. The causative gene was identified as a missense substitution (c. 160 T > C, p. Phe54Leu) in exon 3 of Txn1. | 288084580 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 288084580 | 2026-08-29 11:49:59 | 0 | |||||
|
WMI/Eer Resource Report Resource Website |
RRID:RGD_155641235 | Rattus norvegicus | 3 pairs of WKY males and females with highest immobility and lowest climbing scores in the forced swim test were mated. Dept. of Psychiatry and Behavioral Sciences, Northwestern University Feinberg School of Medicine, Chicago, Illinois. Rat Resource and Research Center | 155641235 | inbred | Rat Genome Database (RGD) | RGD | Unknown | 155641235 | 2026-08-29 11:49:58 | 0 | |||||
|
WLI/Eer Resource Report Resource Website |
RRID:RGD_155641237 | Rattus norvegicus | 3 pairs of WKY males and females with lowest immobility and highest climbing scores in the forced swim test were mated. Dept. of Psychiatry and Behavioral Sciences, Northwestern University Feinberg School of Medicine, Chicago, Illinois. Now deposited at Rat Resource and Research Center | 155641237 | inbred | Rat Genome Database (RGD) | RGD | Unknown | 155641237 | 2026-08-29 11:49:59 | 0 | |||||
|
SD-Tg(Oprm1-icre)1Ottc Resource Report Resource Website |
RRID:RGD_155641245 | Rattus norvegicus | Targeted knock-in adding a T2A-iCre to the Oprm1 (mu opioid receptor) in this cre recombinase reporter SD rat This rat was produced by Optogenetics and Transgenic Technology Core and now cryopreserved at RRRC. | 155641245 | transgenic | Rat Genome Database (RGD) | RGD | Unknown | 155641245 | 2026-08-29 11:49:59 | 0 | |||||
|
LAD Resource Report Resource Website |
RRID:RGD_156451370 | Rattus norvegicus | These low-alcohol-drinking were developed by selective breeding from the heterogeneous strain N:NIH (RGD:728185). 8 inbred rat strains were intercrossed for alcohol preference and consumption. Within-family selection and a rotational breeding design were employed to reduce inbreeding and to allow maintenance of non-inbred replicate lines. | 156451370 | outbred | Rat Genome Database (RGD) | RGD | Unknown | 156451370 | 2026-08-29 11:49:58 | 0 | |||||
|
SD-Mecp2em1Sage/Hsd Resource Report Resource Website 1+ mentions |
RRID:RGD_156430169 | Rattus norvegicus | The MeCP2 KO rat model was originally created at SAGE Labs, Inc. in St. Louis, MO and distributed out of the Boyertown, PA facility. The line continues to be maintained through the original SAGE Labs animal inventory acquired by Envigo. The ZFN mutant rat strain was produced by injecting zinc finger nuclease targeting rat Mecp2 into Sprague Dawley embryos. This mutant rat has a knockout of the methyl CpG binding protein 2 (Mecp2). ENVIGO | 156430169 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Embryo (as of 2023-02-22) | 156430169 | 2026-08-29 11:49:58 | 2 | |||||
|
HAD Resource Report Resource Website |
RRID:RGD_156451369 | Rattus norvegicus | These high-alcohol-drinking rats were developed by selective breeding from the heterogeneous N/N (N:NIH) strain . 8 inbred rat strains were intercrossed for alcohol preference and consumption.Within-family selection and a rotational breeding design were employed to reduce inbreeding and to allow maintenance of non-inbred replicate lines | 156451369 | outbred | Rat Genome Database (RGD) | RGD | Unknown | 156451369 | 2026-08-29 11:49:58 | 0 | |||||
|
MWF/HsdMcwi Resource Report Resource Website |
RRID:RGD_156340304 | Rattus norvegicus | These are re-derived rats of from substrain of Munich Wistar stock, inbred by Harlan Sprague Dawley and now maintained at Medical College of Wisconsin RGD HRDP, contact Hybrid Rat Diversity Panel at [email protected] | 156340304 | inbred | Rat Genome Database (RGD) | RGD | Live Animals; Cryopreserved Embryo (as of 2023-10-24) | 156340304 | 2026-08-29 11:49:58 | 0 | |||||
|
CD-Tg(RNECO-180E22)733Arno Resource Report Resource Website |
RRID:RGD_155663367 | Rattus norvegicus | This transgenic model line 733 was made by injecting bacterial artificial chromosome (BAC) RNECO-180E22, into Crl:CD(SD) strain embryos. The BAC clone RNECO-180E22, a kind gift of Helen Skaletsky, is derived from Rattus norvegicus strain SHR chromosome Y. | 155663367 | transgenic | Rat Genome Database (RGD) | RGD | Unknown | 155663367 | 2026-08-29 11:49:59 | 0 | |||||
|
SS-Chr 3BN.SS-(D3Rat 86-D3Rat218).Il2rgem1/Mcwi Resource Report Resource Website |
RRID:RGD_155791440 | Rattus norvegicus | Immunodeficient subcongenic line developed by intercross SS-Chr 3BN.SS-(D3Rat222-D3Rat218).Il2rgem1Mcwi/Mcwi (RGD:155791433) heterozygous congenic, Il2rg null mutant (X-SCID) lines. Contact MCW rat distribution at [email protected] for availability. | 155791440 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 155791440 | 2026-08-29 11:49:59 | 0 | |||||
|
LEXF7A/StmMcwi Resource Report Resource Website |
RRID:RGD_156430083 | Rattus norvegicus | This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. This substrain was maintained at Medical College of Wisconsin RGD HRDP, contact HRDP | 156430083 | recombinant_inbred | Rat Genome Database (RGD) | RGD | Live Animals; Cryopreserved Embryo (as of 2023-10-24) | 156430083 | 2026-08-29 11:49:59 | 0 | |||||
|
LEXF1C/StmMcwi Resource Report Resource Website |
RRID:RGD_153344519 | Rattus norvegicus | This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. This substrain was maintained at Medical College of Wisconsin RGD HRDP, contact HRDP | 153344519 | recombinant_inbred | Rat Genome Database (RGD) | RGD | Live Animals; Cryopreserved Embryo (as of 2023-10-24) | 153344519 | 2026-08-29 11:49:59 | 0 | |||||
|
FXLE15/StmMcwi Resource Report Resource Website |
RRID:RGD_153344518 | Rattus norvegicus | This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. This substrain was maintained at Medical College of Wisconsin RGD HRDP, contact HRDP | 153344518 | recombinant_inbred | Rat Genome Database (RGD) | RGD | Live Animals; Cryopreserved Embryo (as of 2023-10-24) | 153344518 | 2026-08-29 11:49:59 | 0 | |||||
|
WI;WDB-ROSA26tm1(H2B-tdTomato)/Nips Resource Report Resource Website |
RRID:RGD_155269039 | Rattus norvegicus | PCR products of the human H2BC11 (H2B-6), tdTomato, splice acceptor sequence, and IRES-Neor-SV40pA were inserted into the NheI site of prROSA26-1 with an in-fusion cloning kit. The final tdTomato-H2B-6 targeting vector was linearized by SalI digestion. The vector was introduced into WDB/Nips-ES1/Nips (RGD ID:10054010) embryonic stem cells by electroporation. Targeted ES cells were injected into Crlj:WI (RGD ID: 2312504) blastocysts to produce chimeric rats. The chimeric rats were crossed with Crlj:WI rats to produce heterozygous founder rats.These rat strains are being maintained by crossing the founder rats with Crlj:WI rats. ROSA26 is a synonym for rat Thumpd3-as1 (RGD:6491660) and is used as an official symbol for rat strain nomenclature. Section of Mammalian Transgenesis Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, Okazaki Aichi, JAPAN | 155269039 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Embryo (as of 2022-10-11) | 155269039 | 2026-08-29 11:49:59 | 0 | |||||
|
SD-Tg(Acr3-EGFP)Nips Resource Report Resource Website |
RRID:RGD_401799619 | Rattus norvegicus | This transgenic strain was created by intracytoplasmic sperm injection (ICSI) mediated DNA transfer. Linearized Acr3-EGFP plasmid DNA (Nakanishi et al., FEBS Lett. 1999; 0.1 micrograms/ml) is mixed with sperm heads of Slc:SD rats for 2 min. The sperm head is microinjected into ovulated oocytes of Slc:SD rat (RGD ID:12910483) and incubated overnight prior to embryo transfer to pseudopregnant females. Resultant pups are examined for correct gene-targeting by genomic PCR, and maintained by crossing the founder with Slc:SD rat. Section of Mammalian Transgenesis Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, Okazaki Aichi 444-8787, Japan. or Division of Mammalian Embryology, Center for Stem Cell Biology and Regenerative Medicine, The Institute for Medical Science, The University of Tokyo, Tokyo108-8639, Japan. | 401799619 | transgenic | Rat Genome Database (RGD) | RGD | Cryopreserved Embryo; Cryopreserved Sperm (as of 2023-09-12) | 401799619 | 2026-08-29 11:50:00 | 0 | |||||
|
Ibd:WI Resource Report Resource Website |
RRID:RGD_329812004 | Rattus norvegicus | The Wistar rats maintained at The Nencki Institute of Experimental Biology of the Polish Academy of Sciences, Warsaw, Poland | 329812004 | outbred | Rat Genome Database (RGD) | RGD | Unknown | 329812004 | 2026-08-29 11:49:59 | 0 | |||||
|
SS-Del(1q)2Mcwi Resource Report Resource Website |
RRID:RGD_404976873 | Rattus norvegicus | Four single guide RNAs and SpCas9 targeting sequences CTTCATTGTATGAGCAGCCG, TTTGAAAGAGACAGCTGCCT, ACGCACGTCGGACAGTTCCA, and GGCTTATTGCGCACGCACGT flanking a chromosome 1 region were targeted in SS/JrHsdMcwi embryos. An 82-bp deletion in chromosome 1 (rn7: chr1:255,749,164-255,749,245) resulted. Please contact: [email protected] | 404976873 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2024-03-18) | 404976873 | 2026-08-29 11:50:00 | 0 | |||||
|
Mlac:WR Resource Report Resource Website |
RRID:RGD_156420152 | Rattus norvegicus | This outbred Wistar was maintained at National Laboratory Animal Center (NLAC), Thailand. All animals were housed at the Chulalongkorn University Laboratory Animal Center (CULAC) . National Laboratory Animal Center, Mahidol University Thailand | 156420152 | outbred | Rat Genome Database (RGD) | RGD | Unknown | 156420152 | 2026-08-29 11:49:59 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.