Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=155782877
Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Live Animals (as of 2022-12-07)
Alternate IDs: 155782877
Notes: Imported from Kyoto University in 2010, now maintained at Molecular Embryological & DNA Methylation Lab at National Chung Hsing University, Taiwan.
Proper citation: RRID:RGD_155782877 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=156420139
Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Live Animals; Cryopreserved Embryo (as of 2024-08-06)
Alternate IDs: 156420139
Notes: These are re-derived rats of MNS/N now maintained at Medical College of Wisconsin. Origin: Wistar rats with brother x sister mating and selection for low systolic blood pressure as a normotensive control for MHS. RGD HRDP, contact Hybrid Rat Diversity Program at
[email protected]
Proper citation: RRID:RGD_156420139 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=288084580
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 288084580
Notes: This mutation Phe54Leu is an autosomal dominant mutation that appeared in a stock of F344/NSlc rats that had been mutagenized with N-ethyl-N-nitrosourea (ENU). Rats heterozygous for Txn1 (Txn1 /+) exhibited running seizures only in its juvenile stage. The rat called Adem rat, exhibited age dependent mitochondrial cytopathy (Adem). The rats were backcrossed for more than ten generations on the F344/NSlc inbred background to ensure other mutations induced by ENU was reduced. The causative gene was identified as a missense substitution (c. 160 T > C, p. Phe54Leu) in exon 3 of Txn1.
Proper citation: RRID:RGD_288084580 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=155641235
Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Unknown
Alternate IDs: 155641235
Notes: 3 pairs of WKY males and females with highest immobility and lowest climbing scores in the forced swim test were mated. Dept. of Psychiatry and Behavioral Sciences, Northwestern University Feinberg School of Medicine, Chicago, Illinois.
Rat Resource and Research Center
Proper citation: RRID:RGD_155641235 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=155641237
Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Unknown
Alternate IDs: 155641237
Notes: 3 pairs of WKY males and females with lowest immobility and highest climbing scores in the forced swim test were mated. Dept. of Psychiatry and Behavioral Sciences, Northwestern University Feinberg School of Medicine, Chicago, Illinois. Now deposited at
Rat Resource and Research Center
Proper citation: RRID:RGD_155641237 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=155641245
Source Database: Rat Genome Database (RGD)
Genetic Background: transgenic
Availability: Unknown
Alternate IDs: 155641245
Notes: Targeted knock-in adding a T2A-iCre to the Oprm1 (mu opioid receptor) in this cre recombinase reporter SD rat This rat was produced by Optogenetics and Transgenic Technology Core and now cryopreserved at RRRC.
Proper citation: RRID:RGD_155641245 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=156451370
Source Database: Rat Genome Database (RGD)
Genetic Background: outbred
Availability: Unknown
Alternate IDs: 156451370
Notes: These low-alcohol-drinking were developed by selective breeding from the heterogeneous strain N:NIH (RGD:728185). 8 inbred rat strains were intercrossed for alcohol preference and consumption. Within-family selection and a rotational breeding design were employed to reduce inbreeding and to allow maintenance of non-inbred replicate lines.
Proper citation: RRID:RGD_156451370 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=156430169
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Embryo (as of 2023-02-22)
Alternate IDs: 156430169
Notes: The MeCP2 KO rat model was originally created at SAGE Labs,
Inc. in St. Louis, MO and distributed out of the Boyertown, PA
facility. The line continues to be maintained through the original
SAGE Labs animal inventory acquired by Envigo. The ZFN mutant rat strain was produced by injecting zinc finger nuclease targeting rat Mecp2 into Sprague Dawley embryos. This mutant rat has a knockout of the methyl CpG binding protein 2 (Mecp2). ENVIGO
Proper citation: RRID:RGD_156430169 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=156451369
Source Database: Rat Genome Database (RGD)
Genetic Background: outbred
Availability: Unknown
Alternate IDs: 156451369
Notes: These high-alcohol-drinking rats were developed by selective breeding from the heterogeneous N/N (N:NIH) strain . 8 inbred rat strains were intercrossed for alcohol preference and consumption.Within-family selection and a rotational breeding design were employed to reduce inbreeding and to allow maintenance of non-inbred replicate lines
Proper citation: RRID:RGD_156451369 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=156340304
Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Live Animals; Cryopreserved Embryo (as of 2023-10-24)
Alternate IDs: 156340304
Notes: These are re-derived rats of from substrain of Munich Wistar stock, inbred by Harlan Sprague Dawley and now maintained at Medical College of Wisconsin RGD HRDP, contact Hybrid Rat Diversity Panel at
[email protected]
Proper citation: RRID:RGD_156340304 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=155663367
Source Database: Rat Genome Database (RGD)
Genetic Background: transgenic
Availability: Unknown
Alternate IDs: 155663367
Notes: This transgenic model line 733 was made by injecting bacterial artificial chromosome (BAC) RNECO-180E22, into Crl:CD(SD) strain embryos. The BAC clone RNECO-180E22, a kind gift of Helen Skaletsky, is derived from Rattus norvegicus strain SHR chromosome Y.
Proper citation: RRID:RGD_155663367 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=155791440
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 155791440
Notes: Immunodeficient subcongenic line developed by intercross SS-Chr 3BN.SS-(D3Rat222-D3Rat218).Il2rgem1Mcwi/Mcwi (RGD:155791433) heterozygous congenic, Il2rg null mutant (X-SCID) lines. Contact MCW rat distribution at [email protected] for availability.
Proper citation: RRID:RGD_155791440 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=156430083
Source Database: Rat Genome Database (RGD)
Genetic Background: recombinant_inbred
Availability: Live Animals; Cryopreserved Embryo (as of 2023-10-24)
Alternate IDs: 156430083
Notes: This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. This substrain was maintained at Medical College of Wisconsin RGD HRDP, contact HRDP
Proper citation: RRID:RGD_156430083 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=153344519
Source Database: Rat Genome Database (RGD)
Genetic Background: recombinant_inbred
Availability: Live Animals; Cryopreserved Embryo (as of 2023-10-24)
Alternate IDs: 153344519
Notes: This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. This substrain was maintained at Medical College of Wisconsin RGD HRDP, contact HRDP
Proper citation: RRID:RGD_153344519 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=153344518
Source Database: Rat Genome Database (RGD)
Genetic Background: recombinant_inbred
Availability: Live Animals; Cryopreserved Embryo (as of 2023-10-24)
Alternate IDs: 153344518
Notes: This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. This substrain was maintained at Medical College of Wisconsin RGD HRDP, contact HRDP
Proper citation: RRID:RGD_153344518 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=155269039
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Embryo (as of 2022-10-11)
Alternate IDs: 155269039
Notes: PCR products of the human H2BC11 (H2B-6), tdTomato, splice acceptor sequence, and IRES-Neor-SV40pA were inserted into the NheI site of prROSA26-1 with an in-fusion cloning kit. The final tdTomato-H2B-6 targeting vector was linearized by SalI digestion. The vector was introduced into WDB/Nips-ES1/Nips (RGD ID:10054010) embryonic stem cells by electroporation. Targeted ES cells were injected into Crlj:WI (RGD ID: 2312504) blastocysts to produce chimeric rats. The chimeric rats were crossed with Crlj:WI rats to produce heterozygous founder rats.These rat strains are being maintained by crossing the founder rats with Crlj:WI rats. ROSA26 is a synonym for rat Thumpd3-as1 (RGD:6491660) and is used as an official symbol for rat strain nomenclature. Section of Mammalian Transgenesis Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, Okazaki Aichi, JAPAN
Proper citation: RRID:RGD_155269039 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=401799619
Source Database: Rat Genome Database (RGD)
Genetic Background: transgenic
Availability: Cryopreserved Embryo; Cryopreserved Sperm (as of 2023-09-12)
Alternate IDs: 401799619
Notes: This transgenic strain was created by intracytoplasmic sperm injection (ICSI) mediated DNA transfer. Linearized Acr3-EGFP plasmid DNA (Nakanishi et al., FEBS Lett. 1999; 0.1 micrograms/ml) is mixed with sperm heads of Slc:SD rats for 2 min. The sperm head is microinjected into ovulated oocytes of Slc:SD rat (RGD ID:12910483) and incubated overnight prior to embryo transfer to pseudopregnant females. Resultant pups are examined for correct gene-targeting by genomic PCR, and maintained by crossing the founder with Slc:SD rat. Section of Mammalian Transgenesis Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, Okazaki Aichi 444-8787, Japan. or Division of Mammalian Embryology, Center for Stem Cell Biology and Regenerative Medicine, The Institute for Medical Science, The University of Tokyo, Tokyo108-8639, Japan.
Proper citation: RRID:RGD_401799619 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=329812004
Source Database: Rat Genome Database (RGD)
Genetic Background: outbred
Availability: Unknown
Alternate IDs: 329812004
Notes: The Wistar rats maintained at The Nencki Institute of Experimental Biology of the Polish Academy of Sciences, Warsaw, Poland
Proper citation: RRID:RGD_329812004 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=404976873
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2024-03-18)
Alternate IDs: 404976873
Notes: Four single guide RNAs and SpCas9 targeting sequences CTTCATTGTATGAGCAGCCG, TTTGAAAGAGACAGCTGCCT, ACGCACGTCGGACAGTTCCA, and GGCTTATTGCGCACGCACGT flanking a chromosome 1 region were targeted in SS/JrHsdMcwi embryos. An 82-bp deletion in chromosome 1 (rn7: chr1:255,749,164-255,749,245) resulted. Please contact: [email protected]
Proper citation: RRID:RGD_404976873 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=156420152
Source Database: Rat Genome Database (RGD)
Genetic Background: outbred
Availability: Unknown
Alternate IDs: 156420152
Notes: This outbred Wistar was maintained at National Laboratory Animal Center (NLAC), Thailand. All animals were housed at the Chulalongkorn University Laboratory Animal Center (CULAC) . National Laboratory Animal Center, Mahidol University Thailand
Proper citation: RRID:RGD_156420152 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.