Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00055582
Source Database: WormBase (WB)
Affected Genes: WBGene00001803(lite-1)|WBGene00001804(gur-3)
Genomic Alteration: WBGene00001803(lite-1), WBGene00001804(gur-3)
Availability: unknown
Source References: EMPTY
Synonyms: otIs670 V; lite-1(ce314) gur-3(ok2245) X; flvIs17.
Notes: flvIs17 [tag-168::NLS::GCaMP7F + gcy-28.d::NLS::tagRFPt + ceh-36::NLS::tagRFPt + inx-1::tagRFPt + mod-1::tagRFPt + tph-1(short)::NLS::tagRFPt + gcy-5::NLS-;:tagRFPt + gcy-7::NLS::tagRFPt]. See description of strain OH15263 for full description of otIs670 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). This strain can be used for pan-neuronal calcium imaging. Back-crossed 5x to MT21793 after transgene integration. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https:|"Made_by: Steve Flavell"
Proper citation: RRID:WB-STRAIN:WBStrain00055582 Copy
http://www.wormbase.org/db/get?name=WBStrain00055627
Source Database: WormBase (WB)
Affected Genes: WBGene00001751(gst-3)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00001751(gst-3), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: gst-3(hd7048[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV.
Notes: Homozygous viable. Deletion of 724 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTTTTAAAAGTTTATCGTTTTCAATATCCA; Right flanking sequence: TGGAGCAACTGGCCAGATGCACACTTATCT. sgRNA #1: GTTGATTAATGCCGAGTTGT; sgRNA #2: GCTCAGGAGACACAGACAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: VH KO group"
Proper citation: RRID:WB-STRAIN:WBStrain00055627 Copy
http://www.wormbase.org/db/get?name=WBStrain00055626
Source Database: WormBase (WB)
Affected Genes: WBGene00001763(gst-15)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00001763(gst-15), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: gst-15(hd7047[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II.
Notes: Homozygous viable. Deletion of 2693 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTGCTCTTTTTGAGAATTCGATTGAGAAGA; Right flanking sequence: GACATTTCGGCGGCAGTCAACATTAATGAA. sgRNA #1: ATAAAGTAGACATCTCGAGC; sgRNA #2: CTTGTCAATACTCTCTCACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: VH KO group"
Proper citation: RRID:WB-STRAIN:WBStrain00055626 Copy
http://www.wormbase.org/db/get?name=WBStrain00055589
Source Database: WormBase (WB)
Affected Genes: WBGene00004187(prp-8)|WBGene00006805(unc-73)
Genomic Alteration: WBGene00004187(prp-8), WBGene00006805(unc-73)
Availability: unknown
Source References: EMPTY
Synonyms: unc-73(e936) I; prp-8(az117) III.
Notes: prp-8(az117) is a CRISPR-engineered R540K missense allele that suppress unc-73(e936) uncoordination through activation of an in-frame cryptic 5'ss. Reference: Cartwright-Acar CH, et al. Nucleic Acids Res. 2022 Nov 11;50(20):11834-11857. doi: 10.1093/nar/gkac991. PMID: 36321655.
Proper citation: RRID:WB-STRAIN:WBStrain00055589 Copy
http://www.wormbase.org/db/get?name=WBStrain00055622
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00011241(mpz-5)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00011241(mpz-5)
Availability: unknown
Source References: EMPTY
Synonyms: mpz-5(hd7014[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV.
Notes: Homozygous viable. Deletion of 1364 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAATAAGAAAGTTTTTTTTTTAATTTTTAA; Right flanking sequence: ATGCCCGTTGCCATGCCGTTGTTCCGATAG. sgRNA #1: AAAGCTGTCTCACAAAGTAA; sgRNA #2: GAGGAGGAAAGGAATTAGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: VH KO group"
Proper citation: RRID:WB-STRAIN:WBStrain00055622 Copy
http://www.wormbase.org/db/get?name=WBStrain00055625
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006701(ubc-1)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006701(ubc-1), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: ubc-1(hd7046[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV.
Notes: Homozygous viable. Deletion of 2049 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGGAGTTAGGTTATCAATATGACGACGCCC; Right flanking sequence: TGGAAATTGAAGAAATTGCTGCTCCAGGAG. sgRNA #1: CTCATCAAACGTCTACGGCT; sgRNA #2: CGCAGTGCTCAAGGATGACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: VH KO group"
Proper citation: RRID:WB-STRAIN:WBStrain00055625 Copy
http://www.wormbase.org/db/get?name=WBStrain00055624
Source Database: WormBase (WB)
Affected Genes: WBGene00000287(cal-3)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00000287(cal-3), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: cal-3(hd7045[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV.
Notes: Homozygous viable. Deletion of 6270 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AACGTACGTTATACGTAATAGAAGCACGTG; Right flanking sequence: CTCGGGGCGAATTCAAATAAAGATGCGGCT. sgRNA #1: CGTAATAGAAGCACGTGAGA; sgRNA #2: CGCAATTTGATCACACTCTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: VH KO group"
Proper citation: RRID:WB-STRAIN:WBStrain00055624 Copy
http://www.wormbase.org/db/get?name=WBStrain00055591
Source Database: WormBase (WB)
Affected Genes: WBGene00006805(unc-73)|WBGene00012896(snrp-200)
Genomic Alteration: WBGene00006805(unc-73), WBGene00012896(snrp-200)
Availability: unknown
Source References: EMPTY
Synonyms: unc-73(e936) I; snrp-200(az123) II.
Notes: az123 is an N18K missense allele altering 5' cryptic splicing usage. az123 is a CRISPR-induced mutation mimicking a known suppressor of unc-73(e936). Reference: Cartwright-Acar CH, et al. Nucleic Acids Res. 2022 Nov 11;50(20):11834-11857. doi: 10.1093/nar/gkac991. PMID: 36321655.
Proper citation: RRID:WB-STRAIN:WBStrain00055591 Copy
http://www.wormbase.org/db/get?name=WBStrain00055691
Source Database: WormBase (WB)
Affected Genes: WBGene00006784(unc-49)
Genomic Alteration: WBGene00006784(unc-49)
Availability: unknown
Source References: EMPTY
Synonyms: unc-49(e407) III; hpIs592; ljIs131.
Notes: hpIs592 [ttr-39p::Chrimson::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Shrinker. Body relaxation upon green light illumination with ATR. Reference: Lu Y, et al. 2022. Current Biology (In Press).
Proper citation: RRID:WB-STRAIN:WBStrain00055691 Copy
http://www.wormbase.org/db/get?name=WBStrain00055694
Source Database: WormBase (WB)
Affected Genes: WBGene00006784(unc-49)|WBGene00022675(gbb-2)
Genomic Alteration: WBGene00006784(unc-49), WBGene00022675(gbb-2)
Availability: unknown
Source References: EMPTY
Synonyms: unc-49(e407) III; gbb-2(tm1165) IV; hpIs592; ljIs131.
Notes: hpIs592 [ttr-39p::Chrimson::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Shrinker. Red fluorescence in D motor neurons. Reference: Lu Y, et al. 2022. Current Biology (In Press).
Proper citation: RRID:WB-STRAIN:WBStrain00055694 Copy
http://www.wormbase.org/db/get?name=WBStrain00055699
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: hpIs596; hpIs268.
Notes: hpIs596 [acr-2(s)p::Chrimson::wCherry + lin-15(+)]. hpIs268 [unc-25p::GCaMP3si::SL2 wCherry + lin-15(+)]. Unc (linked to hpIs596). Green and red fluorescence in D-motor neurons. Very weak red fluorescence in A and B motorneurons. Reference: Lim MA, et al. eLife 2016;5:e19887. doi: 10.7554/eLife.19887. PMID: 27855782.
Proper citation: RRID:WB-STRAIN:WBStrain00055699 Copy
http://www.wormbase.org/db/get?name=WBStrain00055732
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: hpIs615; hpIs365.
Notes: hpIs615 [acr-2(s)p::Arch::wCherry + lin-15(+)]. hpIs365 [unc-25p::GCaMP3::wCherry + lin-15(+)]. RFP expression in motor neurons. A and B motor neurons are inhibited and body relaxes upon illumination with green light. Reference: Lu Y, et al. 2022. Current Biology (In Press).
Proper citation: RRID:WB-STRAIN:WBStrain00055732 Copy
http://www.wormbase.org/db/get?name=WBStrain00055735
Source Database: WormBase (WB)
Affected Genes: WBGene00017641(csr-1)
Genomic Alteration: WBGene00017641(csr-1)
Availability: unknown
Source References: EMPTY
Synonyms: fjSi1 II; csr-1(fj54) IV.
Notes: fjSi1 [2FLAG::csr-1 + Cbr-unc-119(+)] II. Single-copy insertion in the MosSCI locus ttTi5605 (LG II). The 2FLAG::csr-1 transgene was designed to express proteins with a double FLAG tag instead of the N169 of CSR-1a and N6 of CSR-1b. The linker sequence between the two FLAG tags has a NotI site. The insertion can be checked by PCR with the following primers: CACACTCGATTCTACGCCAA (at the 3'-side of csr-1) and ATCGGGAGGCGAACCTAACTG (near ttTi5605 on LG II). Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
Proper citation: RRID:WB-STRAIN:WBStrain00055735 Copy
http://www.wormbase.org/db/get?name=WBStrain00055734
Source Database: WormBase (WB)
Affected Genes: WBGene00006762(unc-25)
Genomic Alteration: WBGene00006762(unc-25)
Availability: unknown
Source References: EMPTY
Synonyms: unc-25(e156) III; hpIs673; ljIs131.
Notes: hpIs673 [rgef-1p::Chrimson::UrSL2::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Shrinker. All neurons are marked with red fluorescence. Pan-neuronal activation and muscle contraction upon green light illumination with ATR. Reference: Lu Y, et al. 2022. Current Biology (In Press).
Proper citation: RRID:WB-STRAIN:WBStrain00055734 Copy
http://www.wormbase.org/db/get?name=WBStrain00055685
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: hpIs740.
Notes: hpIs740 [twk-40(s)p::GCaMP6s::wScarlet + lin-15(+)]. GCaMP and RFP expression in AVA, AVB, AVE and DVA. Reference: Lu Y, et al. 2022. Current Biology (In Press).
Proper citation: RRID:WB-STRAIN:WBStrain00055685 Copy
http://www.wormbase.org/db/get?name=WBStrain00055684
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:38598630
Synonyms: hpIs758.
Notes: hpIs758 [rig-3p::LoxP::eBFP::LoxP::Chrimson::wCherry + twk-40(s)p::Cre + myo-2p::wCherry]. Pick animals with red fluorescence to maintain. Weak myo-2 and AVA Cherry expression. hpIs758 is a spontaneous insertion of hpEx4080. Reference: Lu Y, et al. 2022. Current Biology (In Press).
Proper citation: RRID:WB-STRAIN:WBStrain00055684 Copy
http://www.wormbase.org/db/get?name=WBStrain00055687
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: hpIs717; ljIs131.
Notes: hpIs717 [acr-2(s)p::LoxP::eBFP::LoxP::Chrimson::wCherry + unc-17p::Cre + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Red fluorescence in motor neurons. Reference: Lu Y, et al. 2022. Current Biology (In Press).
Proper citation: RRID:WB-STRAIN:WBStrain00055687 Copy
http://www.wormbase.org/db/get?name=WBStrain00055686
Source Database: WormBase (WB)
Affected Genes: WBGene00006762(unc-25)
Genomic Alteration: WBGene00006762(unc-25)
Availability: unknown
Source References: EMPTY
Synonyms: unc-25(e156) III; ljIs131; hpIs758.
Notes: ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. hpIs758 [rig-3p::LoxP::eBFP::LoxP::Chrimson::wCherry + twk-40(s)p::Cre + myo-2p::wCherry]. Pick animals with red fluorescence to maintain. Shrinker. RFP expression in AVA and a few other neurons. Reversal upon green light illumination with ATR. hpIs758 is a spontaneous insertion of hpEx4080. Reference: Lu Y, et al. 2022. Current Biology (In Press).
Proper citation: RRID:WB-STRAIN:WBStrain00055686 Copy
http://www.wormbase.org/db/get?name=WBStrain00055683
Source Database: WormBase (WB)
Affected Genes: WBGene00006762(unc-25)
Genomic Alteration: WBGene00006762(unc-25)
Availability: unknown
Source References: EMPTY
Synonyms: unc-25(e156) III; hpIs593; ljIs131.
Notes: hpIs593 [ttr-39p::Chrimson::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Shrinker. D motor neurons are marked with red fluorescence. No behavioral change upon green light illumination with ATR. Reference: Lu Y, et al. 2022. Current Biology (In Press).
Proper citation: RRID:WB-STRAIN:WBStrain00055683 Copy
http://www.wormbase.org/db/get?name=WBStrain00055726
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: hpIs625; ljIs131.
Notes: hpIs625 [ttr-39p::Arch::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Reference: Lu Y, et al. 2022. Current Biology (In Press).
Proper citation: RRID:WB-STRAIN:WBStrain00055726 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
