Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
SD-Thbdem1Soar Resource Report Resource Website |
RRID:RRRC_01047 | Rattus norvegicus | 1316 bp deletion of the coding region of the Thbd gene Rat Resource and Research Center | 01047 | mutant | Rat Resource and Research Center (RRRC) | RRRC | Live Animals (as of 2025-09-15) | RGD_626469553, 626469553, RRRC_1047, RRRC_01047 | 2026-09-05 02:46:56 | 0 | |||||
|
SD-Lifrem1Soar Resource Report Resource Website |
RRID:RRRC_01058 | Rattus norvegicus | Crispr/Cas9 mediated 88bp deletion of Exon 2 of the Lifr gene Rat Resource and Research Center | 01058 | mutant | Rat Resource and Research Center (RRRC) | RRRC | Live Animals (as of 2025-09-18) | RGD_628359017, 628359017, RRRC_1058, RRRC_01058 | 2026-09-05 02:46:56 | 0 | |||||
|
SD-Epas1em1Soar Resource Report Resource Website |
RRID:RRRC_01060 | Rattus norvegicus | Crispr/Cas9 mediated 34 bp deletion within Exon 2 of the Epas1 gene Rat Resource and Research Center | 01060 | mutant | Rat Resource and Research Center (RRRC) | RRRC | Live Animals (as of 2025-09-18) | RGD_628359016, 628359016, RRRC_1060, RRRC_01060 | 2026-09-05 02:46:56 | 0 | |||||
|
SD-Tfap2cem1Soar Resource Report Resource Website |
RRID:RRRC_01039 | Rattus norvegicus | Crispr/Cas9 mediated 308 bpy deletion within Exon 4 of the Tfap2c gene Rat Resource and Research Center | 01039 | mutant | Rat Resource and Research Center (RRRC) | RRRC | Live Animals (as of 2025-09-15) | RGD_626469558, 626469558, RRRC_1039, RRRC_01039 | 2026-09-05 02:46:56 | 0 | |||||
|
SD-Tfap2cem2Soar Resource Report Resource Website |
RRID:RRRC_01040 | Rattus norvegicus | Crispr/Cas9 mediated insertion of loxp sites flanking Exon 4 of the Tfap2c gene Rat Resource and Research Center | 01040 | mutant | Rat Resource and Research Center (RRRC) | RRRC | Live Animals (as of 2025-09-15) | RGD_626469560, 626469560, RRRC_1040, RRRC_01040 | 2026-09-05 02:46:56 | 0 | |||||
|
ACI-Chib/Kyo Resource Report Resource Website |
RRID:RGD_2314165 | Rattus norvegicus | This strain was established by phenotype-driven ENU mutagenesis. National BioResource Project for the Rat in Japan | 2314165 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm | 2314165 | 2026-09-05 06:52:24 | 0 | |||||
|
F344-Kmch/Kyo Resource Report Resource Website |
RRID:RGD_2314167 | Rattus norvegicus | This strain was established by phenotype-driven ENU mutagenesis. National BioResource Project for the Rat in Japan | 2314167 | mutant | Rat Genome Database (RGD) | RGD | Live Animals; Cryopreserved Sperm | 2314167 | 2026-09-05 06:52:24 | 0 | |||||
|
F344-Tbr1/Kyo Resource Report Resource Website |
RRID:RGD_2314168 | Rattus norvegicus | A mutant rat showing abnormal eyes was found in the G1 rats produced by ENU mutagenesis (phenotype-driven). National BioResource Project for the Rat in Japan | 2314168 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm | 2314168 | 2026-09-05 06:52:24 | 0 | |||||
|
F344-Egrm1Kyo Resource Report Resource Website |
RRID:RGD_2314170 | Rattus norvegicus | , Kaikai, Kyo1897 | This strain was established by phenotype-driven ENU mutagenesis. National BioResource Project for the Rat in Japan | 2314170 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm | 2314170 | 2026-09-05 06:52:24 | 0 | ||||
|
F344-AcoxlTn(sb-T2/Bart3)2.342Mcwi Resource Report Resource Website |
RRID:RGD_2314340 | Rattus norvegicus | These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 10th intron of the Acoxl gene. | 2314340 | mutant | Rat Genome Database (RGD) | RGD | Extinct (as of 2016-10-24) | 2314340 | 2026-09-05 06:52:24 | 0 | |||||
|
ZDF-Leprfa/fa/Crl Resource Report Resource Website 1+ mentions |
RRID:RGD_2311071 | Rattus norvegicus | A mutation occurred in a colony of outbred Zucker rats in the laboratory of Dr. Walter Shaw at Eli Lilly Research Laboratories in Indianapolis, IN in 1974???75. Part of this colony containing the mutation was moved to Indiana University Medical School (IUMS), to the laboratory of Dr. Julia Clark in 1977. Several groups of animals with diabetic lineage were identified and rederived in 1981. Inbreeding of selected pairs from this rederivation was done in the laboratory of Dr. Richard Peterson at IUMS. An inbred line of ZDF rat was established in 1985. To Genetic Models, Inc. in 1991. To Charles River in 2001. Control models for the ZDF Rat (Obese fa/fa) are the ZDF Rat (Lean fa/+) or ZDF Rat (Lean +/?). Charles River Laboratories | 2311071 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 2311071 | 2026-09-05 06:52:24 | 2 | |||||
|
F344-Hrdk/Kyo Resource Report Resource Website |
RRID:RGD_2314362 | Rattus norvegicus | Hairless mutation was found in the G1 rats that established by ENU mutagenesis (phenotype driven). National BioResource Project for the Rat in Japan | 2314362 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm | 2314362 | 2026-09-05 06:52:24 | 0 | |||||
|
BRAT-Avpdi/BluHsd Resource Report Resource Website |
RRID:RGD_2314655 | Rattus norvegicus | Hereditary hypothalamic diabetes insipidus was first described in offspring from a Long-Evans stock of rats by Dr. Schroeder, later named Brattleboro strain. In 1964 from Dr. Lewis Kinder, Harvard University, Boston to Blue Spruce Farms, Altamont, New York. to Harlan through acquisition in 1988. Harlan | 2314655 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Embryo; Cryopreserved Sperm (as of 2018-06-21) | 2314655 | 2026-09-05 06:52:25 | 0 | |||||
|
F344-Hrkrh/Kyo Resource Report Resource Website |
RRID:RGD_2314230 | Rattus norvegicus | , Hanako | A mutant rat showing abnormal skin phenotype was found in the G1 rats produced by ENU mutagenesis (phenotype-driven). National BioResource Project for the Rat in Japan | 2314230 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm | 2314230 | 2026-09-05 06:52:25 | 0 | ||||
|
KFRS2/Kyo Resource Report Resource Website |
RRID:RGD_2314365 | Rattus norvegicus | A male rat "SRR-Do Your Best" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR-Do Your Best" and a female PVG/Seac. National BioResource Project for the Rat in Japan | 2314365 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm | 2314365 | 2026-09-05 06:52:25 | 0 | |||||
|
SS-Renem1Mcwi Resource Report Resource Website |
RRID:RGD_4139880 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence acccttcatgctggccaagtttgacggggttctgggcatg into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 5. | 4139880 | mutant | Rat Genome Database (RGD) | RGD | Live Animals; Cryopreserved Sperm (as of 2017-01-26) | 4139880 | 2026-09-05 06:52:26 | 0 | |||||
|
SS-Nox4em2Mcwi Resource Report Resource Website |
RRID:RGD_4139883 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence ggttacagcttctacctatgcaataaggtaagggtc into SS/JrHsdMcwi rat embryos. The resulting mutation is an 8-bp frameshift deletion in exon 7. | 4139883 | mutant | Rat Genome Database (RGD) | RGD | Live Animals; Cryopreserved Sperm (as of 2017-01-26) | 4139883 | 2026-09-05 06:52:26 | 0 | |||||
|
SS-Sh2b3em1Mcwi Resource Report Resource Website |
RRID:RGD_4139885 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence ctcccccatcccacttgaatgtggagcagcctgtg into SS/JrHsdMcwi rat embryos. The resulting mutation is an in-frame 6-bp deletion in exon 2. | 4139885 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2021-11-03) | 4139885 | 2026-09-05 06:52:26 | 0 | |||||
|
SD-Pax6Sey/Mce Resource Report Resource Website |
RRID:RGD_2325754 | Rattus norvegicus | Autosomal dominant mutation that arose spontaneously in SD rats. Genomic DNA analysis from mutants revealed a single base(G) insertion in the exon generating a novel 5' donor splice site. This led to the internal a 602-bp deletion of Pax6 mRNA. | 2325754 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 2325754 | 2026-09-05 06:52:27 | 0 | |||||
|
AMI/Tj Resource Report Resource Website |
RRID:RGD_4142546 | Rattus norvegicus | Rats which showed a dental mutation such as morphological abnormalities of the teeth were found in the SHR-SP rats at Daiichi Seiyaku, Co., Ltd. in 1981. Transferred to Tokushima University in 2003. National BioResource Project for the Rat in Japan | 4142546 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Embryo | 4142546 | 2026-09-05 06:52:26 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
