Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=626469553
Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Availability: Live Animals (as of 2025-09-15)
Alternate IDs: RGD_626469553, 626469553, RRRC_1047, RRRC_01047
Notes: 1316 bp deletion of the coding region of the Thbd gene Rat Resource and Research Center
Proper citation: RRID:RRRC_01047 Copy
http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=628359017
Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Availability: Live Animals (as of 2025-09-18)
Alternate IDs: RGD_628359017, 628359017, RRRC_1058, RRRC_01058
Notes: Crispr/Cas9 mediated 88bp deletion of Exon 2 of the Lifr gene Rat Resource and Research Center
Proper citation: RRID:RRRC_01058 Copy
http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=628359016
Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Availability: Live Animals (as of 2025-09-18)
Alternate IDs: RGD_628359016, 628359016, RRRC_1060, RRRC_01060
Notes: Crispr/Cas9 mediated 34 bp deletion within Exon 2 of the Epas1 gene Rat Resource and Research Center
Proper citation: RRID:RRRC_01060 Copy
http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=626469558
Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Availability: Live Animals (as of 2025-09-15)
Alternate IDs: RGD_626469558, 626469558, RRRC_1039, RRRC_01039
Notes: Crispr/Cas9 mediated 308 bpy deletion within Exon 4 of the Tfap2c gene Rat Resource and Research Center
Proper citation: RRID:RRRC_01039 Copy
http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=626469560
Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Availability: Live Animals (as of 2025-09-15)
Alternate IDs: RGD_626469560, 626469560, RRRC_1040, RRRC_01040
Notes: Crispr/Cas9 mediated insertion of loxp sites flanking Exon 4 of the Tfap2c gene Rat Resource and Research Center
Proper citation: RRID:RRRC_01040 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=2314165
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm
Alternate IDs: 2314165
Notes: This strain was established by phenotype-driven ENU mutagenesis. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_2314165 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=2314167
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals; Cryopreserved Sperm
Alternate IDs: 2314167
Notes: This strain was established by phenotype-driven ENU mutagenesis. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_2314167 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=2314168
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm
Alternate IDs: 2314168
Notes: A mutant rat showing abnormal eyes was found in the G1 rats produced by ENU mutagenesis (phenotype-driven). National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_2314168 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=2314170
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm
Synonyms: , Kaikai, Kyo1897
Alternate IDs: 2314170
Notes: This strain was established by phenotype-driven ENU mutagenesis. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_2314170 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=2314340
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Extinct (as of 2016-10-24)
Alternate IDs: 2314340
Notes: These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 10th intron of the Acoxl gene.
Proper citation: RRID:RGD_2314340 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=2311071
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 2311071
Notes: A mutation occurred in a colony of outbred Zucker rats in the laboratory of Dr. Walter Shaw at Eli Lilly Research Laboratories in Indianapolis, IN in 1974???75. Part of this colony containing the mutation was moved to Indiana University Medical School (IUMS), to the laboratory of Dr. Julia Clark in 1977. Several groups of animals with diabetic lineage were identified and rederived in 1981. Inbreeding of selected pairs from this rederivation was done in the laboratory of Dr. Richard Peterson at IUMS. An inbred line of ZDF rat was established in 1985. To Genetic Models, Inc. in 1991. To Charles River in 2001. Control models for the ZDF Rat (Obese fa/fa) are the ZDF Rat (Lean fa/+) or ZDF Rat (Lean +/?). Charles River Laboratories
Proper citation: RRID:RGD_2311071 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=2314362
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm
Alternate IDs: 2314362
Notes: Hairless mutation was found in the G1 rats that established by ENU mutagenesis (phenotype driven). National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_2314362 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=2314655
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Embryo; Cryopreserved Sperm (as of 2018-06-21)
Alternate IDs: 2314655
Notes: Hereditary hypothalamic diabetes insipidus was first described in offspring from a Long-Evans stock of rats by Dr. Schroeder, later named Brattleboro strain. In 1964 from Dr. Lewis Kinder, Harvard University, Boston to Blue Spruce Farms, Altamont, New York. to Harlan through acquisition in 1988. Harlan
Proper citation: RRID:RGD_2314655 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=2314230
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm
Synonyms: , Hanako
Alternate IDs: 2314230
Notes: A mutant rat showing abnormal skin phenotype was found in the G1 rats produced by ENU mutagenesis (phenotype-driven). National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_2314230 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=2314365
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm
Alternate IDs: 2314365
Notes: A male rat "SRR-Do Your Best" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR-Do Your Best" and a female PVG/Seac. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_2314365 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=4139880
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals; Cryopreserved Sperm (as of 2017-01-26)
Alternate IDs: 4139880
Notes: This strain was produced by injecting ZFNs targeting the sequence acccttcatgctggccaagtttgacggggttctgggcatg into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 5.
Proper citation: RRID:RGD_4139880 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=4139883
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals; Cryopreserved Sperm (as of 2017-01-26)
Alternate IDs: 4139883
Notes: This strain was produced by injecting ZFNs targeting the sequence ggttacagcttctacctatgcaataaggtaagggtc into SS/JrHsdMcwi rat embryos. The resulting mutation is an 8-bp frameshift deletion in exon 7.
Proper citation: RRID:RGD_4139883 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=4139885
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2021-11-03)
Alternate IDs: 4139885
Notes: This strain was produced by injecting ZFNs targeting the sequence ctcccccatcccacttgaatgtggagcagcctgtg into SS/JrHsdMcwi rat embryos. The resulting mutation is an in-frame 6-bp deletion in exon 2.
Proper citation: RRID:RGD_4139885 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=2325754
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 2325754
Notes: Autosomal dominant mutation that arose spontaneously in SD rats. Genomic DNA analysis from mutants revealed a single base(G) insertion in the exon generating a novel 5' donor splice site. This led to the internal a 602-bp deletion of Pax6 mRNA.
Proper citation: RRID:RGD_2325754 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=4142546
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Embryo
Alternate IDs: 4142546
Notes: Rats which showed a dental mutation such as morphological abnormalities of the teeth were found in the SHR-SP rats at Daiichi Seiyaku, Co., Ltd. in 1981. Transferred to Tokushima University in 2003. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_4142546 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.