Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00037953
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: F42F12.3(gk5201[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X.
Alternate IDs: WB-STRAIN:VC4215, CGC_VC4215
Notes: Homozygous viable. Deletion of 1066 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATCAGTTTTGATTTTAAAGGTATTCCGATG ; Right flanking sequence: ATCGGCATCTAATTTCTAATGCTTCAAGTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00037953 Copy
http://www.wormbase.org/db/get?name=WBStrain00037920
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006365(syg-1)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006365(syg-1), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: syg-1(gk5167[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X.
Alternate IDs: WB-STRAIN:VC4109, CGC_VC4109
Notes: Homozygous viable. Deletion of 2190 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTGATTTTAAGAATACTTTCTTTTCCATAT ; Right flanking sequence: CACGGTTTCTTGAGAGATTTCTGGTTTTGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00037920 Copy
http://www.wormbase.org/db/get?name=WBStrain00037938
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004227(ptr-13)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004227(ptr-13), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: ptr-13(gk5246[loxP + myo-2::GFPp::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II.
Alternate IDs: WB-STRAIN:VC4160, CGC_VC4160
Notes: Homozygous viable. Deletion of 3626 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AAACGGGTACGACGAACAATGGGGCCATGC ; Right flanking sequence: TGACGGCAGGCAGACAGGCAGAACATGTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00037938 Copy
http://www.wormbase.org/db/get?name=WBStrain00040279
Source Database: WormBase (WB)
Affected Genes: WBGene00003262(mir-34)|WBGene00003311(mir-83)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003262(mir-34), WBGene00003311(mir-83), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: unc-54(e190) I; mir-83(n4638) IV; mir-34(gk437) X.
Alternate IDs: WB-STRAIN:VT2812, CGC_VT2812
Notes: Made_by: V Ambros & S Burke|"Paralyzed. DTC migration defect. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15."
Proper citation: RRID:WB-STRAIN:WBStrain00040279 Copy
http://www.wormbase.org/db/get?name=WBStrain00040436
Source Database: WormBase (WB)
Affected Genes: WBGene00001746(gsk-3)|WBGene00006789(unc-54)|WBGene00006829(unc-101)
Genomic Alteration: WBGene00001746(gsk-3), WBGene00006789(unc-54), WBGene00006829(unc-101)
Availability: available
Source References: EMPTY
Synonyms: unc-101(sy216) gsk-3(nr2047)/hIn1 [unc-54(h1040)] I.
Alternate IDs: WB-STRAIN:WM104, CGC_WM104
Notes: Heterozygotes are WT and segregate WT, paralyzed Unc, and coilers which give only dead eggs (low brood size).|"Made_by: Bei Yanxia"
Proper citation: RRID:WB-STRAIN:WBStrain00040436 Copy
http://www.wormbase.org/db/get?name=WBStrain00039075
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: Whole-genome sequenced strain.
Alternate IDs: WB-STRAIN:VC40090, CGC_VC40090
Notes: Homozygous viable. Deletion of 1570 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TCTATATTGTTCTTCACGCCAGGTCTACAA; Right flanking sequence: GGAGGTACCACAACGGAGGTAAATTTGAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"|"Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( URL: genome.sfu.ca/mmp/)."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00039075 Copy
http://www.wormbase.org/db/get?name=WBStrain00039046
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00017901(siss-1)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00017901(siss-1)
Availability: available
Source References: EMPTY
Synonyms: Whole-genome sequenced strain.
Alternate IDs: WB-STRAIN:VC40060, CGC_VC40060
Notes: Homozygous viable. Deletion of 1917 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TTGAAATTGGAGAGAGCAGTGGACAGAGGT; Right flanking sequence: TGAGGGGAATACGCCAGGTTTCGCCAGGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"|"Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( URL: genome.sfu.ca/mmp/)."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00039046 Copy
http://www.wormbase.org/db/get?name=WBStrain00034953
Source Database: WormBase (WB)
Affected Genes: WBGene00004884(smg-6)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00004884(smg-6), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: unc-54(r293) I; smg-6(r1217) III.
Alternate IDs: WB-STRAIN:TR2264, CGC_TR2264
Notes: mut-2 background|"mut-5 background"|"P-Vul. WT movement."
Proper citation: RRID:WB-STRAIN:WBStrain00034953 Copy
http://www.wormbase.org/db/get?name=WBStrain00034951
Source Database: WormBase (WB)
Affected Genes: WBGene00004882(smg-4)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00004882(smg-4), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: unc-54(r293) I; smg-4(r1169) V.
Alternate IDs: WB-STRAIN:TR2192, CGC_TR2192
Notes: P-vul. WT movement.
Proper citation: RRID:WB-STRAIN:WBStrain00034951 Copy
http://www.wormbase.org/db/get?name=WBStrain00034942
Source Database: WormBase (WB)
Affected Genes: WBGene00004883(smg-5)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00004883(smg-5), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: smg-5(r860) unc-54(r293) I.
Alternate IDs: WB-STRAIN:TR1324, CGC_TR1324
Notes: P-Vul.
Proper citation: RRID:WB-STRAIN:WBStrain00034942 Copy
http://www.wormbase.org/db/get?name=WBStrain00035171
Source Database: WormBase (WB)
Affected Genes: WBGene00006598(tor-2)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00006598(tor-2), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: Q19::GFP
Alternate IDs: WB-STRAIN:UA3
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00035171 Copy
http://www.wormbase.org/db/get?name=WBStrain00035177
Source Database: WormBase (WB)
Affected Genes: WBGene00006789(unc-54)
Genomic Alteration: WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:UA38
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00035177 Copy
http://www.wormbase.org/db/get?name=WBStrain00004991
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: F36D4.4(umn4[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V.
Alternate IDs: WB-STRAIN:CGC61, CGC_CGC61
Notes: Homozygous viable. Deletion of 917 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CATGTACTCCCCTATATCTTCCAAACATTC ; Right flanking sequence: TGGACATCTTGGAGCACTTTCTGTGATTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 917 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: CATGTACTCCCCTATATCTTCCAAACATTC ; Right flanking sequence: TGGACATCTTGGAGCACTTTCTGTGATTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of F36D4.4. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: atgacaatgtctcaagggtccatgtactcccctatatcttccaaacattc Right flanking sequence: TGGACATCTTGGAGCACTTTCTGTGATTCTCAATTTATTTGTCATTATTG"
Proper citation: RRID:WB-STRAIN:WBStrain00004991 Copy
http://www.wormbase.org/db/get?name=WBStrain00004989
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00008737(gnrr-7)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00008737(gnrr-7)
Availability: available
Source References: EMPTY
Synonyms: gnrr-7(umn3[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X.
Alternate IDs: WB-STRAIN:CGC59, CGC_CGC59
Notes: Homozygous viable. Deletion of 1004 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ttgttctggtttaaagccgcaaagtcttgg ; Right flanking sequence: agggtaccatcaagcaatggcattctggtt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 1004 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: ttgttctggtttaaagccgcaaagtcttgg ; Right flanking sequence: agggtaccatcaagcaatggcattctggtt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of gnrr-7. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: ATATTTATTTAATATATATTTTGTTCTGGTTTAAAGCCGCAAAGTCTTGG Right flanking sequence: AGGGTACCATCAAGCAATGGCATTCTGGTTGCCCTTAAGCATAACAATTG"
Proper citation: RRID:WB-STRAIN:WBStrain00004989 Copy
http://www.wormbase.org/db/get?name=WBStrain00004988
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: C54E10.3(umn2[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V.
Alternate IDs: WB-STRAIN:CGC58, CGC_CGC58
Notes: Homozygous viable. Deletion of 745 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: tgtacccccgatgggattcgaacctgtggc ; Right flanking sequence: gggtatgcaaaatgaccgcgttttctgtga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 745 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tgtacccccgatgggattcgaacctgtggc ; Right flanking sequence: gggtatgcaaaatgaccgcgttttctgtga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of C54E10.3. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: tctccgcctaaaaaaatatatgtacccccgatgggattcgaacctgtggc Right flanking sequence: GGGTATGCAAAATGACCGCGTTTTCTGTGAATTCATCGTCATGCTTTATT"
Proper citation: RRID:WB-STRAIN:WBStrain00004988 Copy
http://www.wormbase.org/db/get?name=WBStrain00005002
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00021328(npr-23)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00021328(npr-23)
Availability: available
Source References: EMPTY
Synonyms: npr-23(umn5[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I.
Alternate IDs: WB-STRAIN:CGC72, CGC_CGC72
Notes: Homozygous viable. Deletion of 280 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAGGCGTCATCTGGAGAGAAGAACGAAgtg ; Right flanking sequence: CGGACACTTGTGCTTCACCAACTTGATCGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 280 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: AAGGCGTCATCTGGAGAGAAGAACGAAgtg ; Right flanking sequence: CGGACACTTGTGCTTCACCAACTTGATCGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of npr-23. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: cccctgcctctggctcccacaaggcgtcatctggagagaagaacgaagtg Right flanking sequence: CGGACACTTGTGCTTCACCAACTTGATCGCGTTGCTCGTATTGGTGCCGG"
Proper citation: RRID:WB-STRAIN:WBStrain00005002 Copy
http://www.wormbase.org/db/get?name=WBStrain00005081
Source Database: WormBase (WB)
Affected Genes: WBGene00003474(mtl-2)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003474(mtl-2), WBGene00006789(unc-54)
Availability: unknown
Source References: PMID:9751195
Synonyms: N2; dvEx121 [pCL12 (unc-54/b 1-42) + pCL26
Alternate IDs: WB-STRAIN:CL1121
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00005081 Copy
http://www.wormbase.org/db/get?name=WBStrain00005094
Source Database: WormBase (WB)
Affected Genes: WBGene00006789(unc-54)
Genomic Alteration: WBGene00006789(unc-54)
Availability: available
Source References: PMID:7568134, PMID:9751195, PMID:32966472, PMID:34707479, PMID:36226991, PMID:36653384, PMID:37103980, PMID:37522064, PMID:37113386, PMID:37549461, PMID:38983916, PMID:38991033, PMID:39950089
Synonyms: dvIs2 [Punc-54::human A-beta 3-42; pRF4 (rol-6(su1006]
Alternate IDs: WB-STRAIN:CL2006, CGC_CL2006
Notes: dvIs2 [pCL12(unc-54/human Abeta peptide 1-42 minigene) + rol-6(su1006)]. Temperature-sensitive. Maintain at 15C. Adult onset paralysis and egg-laying deficiency when raised at 20C. A few animals will be paralyzed even at permissive temperatures. Received new stock from CL 8/2005.|"WBStrain provided so WBPaper00059477 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00062076 paper added based on AFP_Strain data."|"[2020-08-03T18:23:09.013Z WBPerson324] Ressurect Strain: Paper: WBPaper00002289 Genotype: dvIs2 [Punc-54::human A-beta 3-42; pRF4 (rol-6(su1006]"
Proper citation: RRID:WB-STRAIN:WBStrain00005094 Copy
http://www.wormbase.org/db/get?name=WBStrain00005093
Source Database: WormBase (WB)
Affected Genes: WBGene00006789(unc-54)
Genomic Alteration: WBGene00006789(unc-54)
Availability: unknown
Source References: PMID:7568134, PMID:9751195
Synonyms: dvIs2 [Punc-54::human A-beta 3-42; pRF4 (rol-6(su1006]
Alternate IDs: WB-STRAIN:CL2005
Notes: [2020-08-03T18:27:21.884Z WBPerson324] Ressurect Strain: WBPaper: WBPaper00002289 Genotype: dvIs2 [Punc-54::human A-beta 3-42; pRF4 (rol-6(su1006]
Proper citation: RRID:WB-STRAIN:WBStrain00005093 Copy
http://www.wormbase.org/db/get?name=WBStrain00005007
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: C04C3.6(umn8[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV.
Alternate IDs: WB-STRAIN:CGC78, CGC_CGC78
Notes: Homozygous viable. Deletion of 1123 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aaaaatcaactatttttaatgaaaatttca ; Right flanking sequence: TGGTCACTTTACCTGCGTTGATATTCATGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 1123 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: aaaaatcaactatttttaatgaaaatttca ; Right flanking sequence: TGGTCACTTTACCTGCGTTGATATTCATGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of C04C3.6. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: ttgaaaatttgaaatttgaaaaaaatcaactatttttaatgaaaatttca Right flanking sequence: TGGTCACTTTACCTGCGTTGATATTCATGTTCATCGTGCTTCGAAAGTAC"
Proper citation: RRID:WB-STRAIN:WBStrain00005007 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
