Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
DR37 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00006164 | Caenorhabditis elegans | unc-54(m37) I. | Healthy. Recessive. Dauer recovery slow. Eggs laid rarely. | WBGene00006789(unc-54) | WBGene00006789(unc-54) | WB-STRAIN:WBStrain00006164 | WormBase (WB) | WB | available | WB-STRAIN:DR37, CGC_DR37 | 2026-09-05 04:46:42 | 0 | |||
|
DR31 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00006158 | Caenorhabditis elegans | unc-54(m31) I. | Severe Unc. Very slow growth. Strong semi-dominant. Heterozygous males don't mate. | WBGene00006789(unc-54) | WBGene00006789(unc-54) | WB-STRAIN:WBStrain00006158 | WormBase (WB) | WB | available | WB-STRAIN:DR31, CGC_DR31 | 2026-09-05 04:46:42 | 0 | |||
|
DR119 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00006197 | Caenorhabditis elegans | unc-54(e1258) I; dpy-11(e224) wdDp1 V. | DPY. | WBGene00001073(dpy-11)|WBGene00006789(unc-54) | WBGene00001073(dpy-11), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00006197 | WormBase (WB) | WB | available | WB-STRAIN:DR119, CGC_DR119 | 2026-09-05 04:46:42 | 0 | |||
|
DR631 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00006286 | Caenorhabditis elegans | unc-54(e190) I; sus-1(m156) III. | Made_by: Brown S|"Severly paralyzed Unc. More severe than unc-15 alone." | WBGene00006354(sus-1)|WBGene00006789(unc-54) | WBGene00006354(sus-1), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00006286 | WormBase (WB) | WB | available | PMID:4018568 | WB-STRAIN:DR631, CGC_DR631 | 2026-09-05 04:46:44 | 0 | ||
|
DR290 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00006244 | Caenorhabditis elegans | unc-54(m36) I; him-8(e1489) IV. | Severe Unc. Segregates males. M-MATING-NO SUCCESS. Semi-dominant. Heterozygotes are slow moving. | WBGene00001867(him-8)|WBGene00006789(unc-54) | WBGene00001867(him-8), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00006244 | WormBase (WB) | WB | available | WB-STRAIN:DR290, CGC_DR290 | 2026-09-05 04:46:43 | 0 | |||
|
DR405 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00006253 | Caenorhabditis elegans | unc-54(e190) I; eDf1 eDp21/+ V. | Made_by: | WBGene00006789(unc-54) | WBGene00006789(unc-54) | WB-STRAIN:WBStrain00006253 | WormBase (WB) | WB | available | PMID:2575705 | WB-STRAIN:DR405, CGC_DR405 | 2026-09-05 04:46:43 | 0 | ||
|
MT3778 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027091 | Caenorhabditis elegans | ced-1(e1735) unc-54(e1092) I. | Unc. Abnormal cell death. | WBGene00000415(ced-1)|WBGene00006789(unc-54) | WBGene00000415(ced-1), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00027091 | WormBase (WB) | WB | available | PMID:1936965 | WB-STRAIN:MT3778, CGC_MT3778 | 2026-09-05 04:51:38 | 0 | ||
|
MT6183 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027251 | Caenorhabditis elegans | bli-3(e767) unc-54(e1092) I. | Mapping strain. | WBGene00000253(bli-3)|WBGene00006789(unc-54) | WBGene00000253(bli-3), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00027251 | WormBase (WB) | WB | available | WB-STRAIN:MT6183, CGC_MT6183 | 2026-09-05 04:51:40 | 0 | |||
|
VC40090 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00039075 | Caenorhabditis elegans | Whole-genome sequenced strain. | Homozygous viable. Deletion of 1570 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TCTATATTGTTCTTCACGCCAGGTCTACAA; Right flanking sequence: GGAGGTACCACAACGGAGGTAAATTTGAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"|"Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( URL: genome.sfu.ca/mmp/)."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00039075 | WormBase (WB) | WB | available | WB-STRAIN:VC40090, CGC_VC40090 | 2026-09-05 04:54:22 | 0 | |||
|
VC40060 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00039046 | Caenorhabditis elegans | Whole-genome sequenced strain. | Homozygous viable. Deletion of 1917 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TTGAAATTGGAGAGAGCAGTGGACAGAGGT; Right flanking sequence: TGAGGGGAATACGCCAGGTTTCGCCAGGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"|"Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( URL: genome.sfu.ca/mmp/)."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00017901(siss-1) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00017901(siss-1) | WB-STRAIN:WBStrain00039046 | WormBase (WB) | WB | available | WB-STRAIN:VC40060, CGC_VC40060 | 2026-09-05 04:54:22 | 0 | |||
|
JJ1743 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00022498 | Caenorhabditis elegans | par-6(tm1425)/hIn1 [unc-54(h1040)] I; him-8(e1489) IV. | Heterozygotes are WT and segregate WT, Uncs, dead larvae (par-6 homozygotes) and males. | WBGene00001867(him-8)|WBGene00003921(par-6)|WBGene00006789(unc-54) | WBGene00001867(him-8), WBGene00003921(par-6), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00022498 | WormBase (WB) | WB | available | PMID:39652540 | WB-STRAIN:JJ1743, CGC_JJ1743 | 2026-09-05 04:50:30 | 0 | ||
|
KK818 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00023575 | Caenorhabditis elegans | par-6(zu222) unc-101(m1)/hIn1 [unc-54(h1040)] I. | Heterozygotes are WT and segregate WT, paralyzed Unc, and Coilers which give only dead eggs (slightly leaky, but survivors are agametic). zu222 is a strict maternal effect embryonic lethal. Partitioning defect similar to that of par-3; fails to localize PAR-3 protein.|"mut-6 background" | WBGene00003921(par-6)|WBGene00006789(unc-54)|WBGene00006829(unc-101) | WBGene00003921(par-6), WBGene00006789(unc-54), WBGene00006829(unc-101) | WB-STRAIN:WBStrain00023575 | WormBase (WB) | WB | available | PMID:8898226 | WB-STRAIN:KK818, CGC_KK818 | 2026-09-05 04:50:47 | 0 | ||
|
T13C5.10(ve753[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051892 | Caenorhabditis elegans | T13C5.10(ve753[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. | Homozygous viable. Deletion of 1497 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gtcacgtaaaattttcaaaatggttgacca ; Right flanking sequence: AGGATAAtaaaaaatcgtattttaaatgct. sgRNA #1: tatgtacacctgccccaaaa; sgRNA #2: ACGTGCCAATCAGTAGTGTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00051892 | WormBase (WB) | WB | unknown | 2026-09-05 04:57:16 | 0 | ||||
|
+/nT1[umnIs49] IV; F53F4.11(ve761[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051896 | Caenorhabditis elegans | +/nT1[umnIs49] IV; F53F4.11(ve761[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. | Made_by: RG KO Group|"umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous early larval lethal. Deletion of 1620 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate dead larvae (ve761 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: CATGCACAGTTGGGAACAGTACAGACTGAT ; Right flanking sequence: AGGAGCAACTGACTTCACAACCTGCAGCTC. sgRNA #1: CGGTATCTTCCTTGAGAACA; sgRNA #2: TTCTTCGCAACTTCAACTGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation." | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00051896 | WormBase (WB) | WB | unknown | 2026-09-05 04:57:16 | 0 | ||||
|
tmed-3(ve760[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051895 | Caenorhabditis elegans | tmed-3(ve760[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. | Homozygous viable. Deletion of 725 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ttgaaaatcgtagaaactgtaataatttga ; Right flanking sequence: tcctccctttgatacatagcataagaatat. sgRNA #1: taatttcagGTTGTTACTGG; sgRNA #2: aaaggggcaaaacaactgac. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00019003(tmed-3) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00019003(tmed-3) | WB-STRAIN:WBStrain00051895 | WormBase (WB) | WB | unknown | 2026-09-05 04:57:16 | 0 | ||||
|
F35H12.5(ve755[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051893 | Caenorhabditis elegans | F35H12.5(ve755[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. | Homozygous viable. Deletion of 1604 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tcagATGTTTTCTTCACGTCATATTTTATC ; Right flanking sequence: GATTCTATTTTTGATGCTGACAAAGAAGTC. sgRNA #1: AAACGTTCGTCCAATAATAA; sgRNA #2: CACAACTTCTACAATAAACT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00051893 | WormBase (WB) | WB | unknown | 2026-09-05 04:57:16 | 0 | ||||
|
dxbp-1(gk5666[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051898 | Caenorhabditis elegans | dxbp-1(gk5666[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. | Made_by: Morgan Zaic|"umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5666 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VC4596 and CGC92. gk5666 is a 2234 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GGTGGGCGGCAAAATATTTTTTCCGCCAAACCGGCAAATTGCCGGAATTGAAAATTTCCG. Right flanking sequence: TTCGGAAGTTAAGTGGCATTTGAAGCCGTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation." | WBGene00000254(bli-4)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00013128(dxbp-1) | WBGene00000254(bli-4), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00013128(dxbp-1) | WB-STRAIN:WBStrain00051898 | WormBase (WB) | WB | unknown | 2026-09-05 04:57:16 | 0 | ||||
|
+/mT1 [umnIs52] II; C16C10.2(gk5524[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mT1 [dpy-10(e128)] III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051930 | Caenorhabditis elegans | +/mT1 [umnIs52] II; C16C10.2(gk5524[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mT1 [dpy-10(e128)] III. | Made_by: Morgan Zaic|"umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5524 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4449 and CGC66. gk5524 is a 957 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TAACTACTTCTTTCGTTCATAGGTCCATTT. Right flanking sequence: CGAGGACATGGCTGGCTGAAAATAATTTTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation." | WBGene00001072(dpy-10)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00001072(dpy-10), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00051930 | WormBase (WB) | WB | unknown | 2026-09-05 04:57:16 | 0 | ||||
|
msp-59(ve738[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051880 | Caenorhabditis elegans | msp-59(ve738[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. | Homozygous viable. Deletion of 722 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: attggaaggtggcctccacctccaccaaat ; Right flanking sequence: tccccctatcgataaacttcaacactacaa. sgRNA #1: attcaaaagcgtatcaaatt; sgRNA #2: ggcatttcatgtgaattaag. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00003452(msp-59)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003452(msp-59), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00051880 | WormBase (WB) | WB | unknown | 2026-09-05 04:57:16 | 0 | ||||
|
F54B11.5(ve743[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051885 | Caenorhabditis elegans | F54B11.5(ve743[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. | Homozygous viable. Deletion of 1530 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tagaTCAAGTTTCACGGGCGATTTCCTTCA ; Right flanking sequence: cggaattagtcatgcaaaacacatgacatc. sgRNA #1: AATACTCGTTCACTTCAGCC; sgRNA #2: aagaaaaacgtatgtttatg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00051885 | WormBase (WB) | WB | unknown | 2026-09-05 04:57:16 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
