Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5131933
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2021-11-03)
Alternate IDs: 5131933
Notes: This strain was produced by injecting ZFNs targeting the sequence CGAGTGGGCCATgtgggCCAACGAACAGGCGC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 36-bp frameshift deletion in exon 1.
Proper citation: RRID:RGD_5131933 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5508370
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2017-01-26)
Alternate IDs: 5508370
Notes: This strain was produced by injecting ZFNs targeting the sequence TTCCCAATTCGTCACAgaagctGCTGGAGCTGATAAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 100-bp deletion of part of intron 1 and exon 2.
Proper citation: RRID:RGD_5508370 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5508371
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Extinct
Alternate IDs: 5508371
Notes: This strain was produced by injecting ZFNs targeting the sequence GCCCCAGCCATGCTGTGCtatgtGACGAGGCCGGACGCGGTG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 51-bp frameshift deletion in exon 1.
Proper citation: RRID:RGD_5508371 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=6484562
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2017-01-26)
Alternate IDs: 6484562
Notes: This strain was produced by injecting ZFNs targeting the sequence TGGATCCCACGAAGCcagtgtGTTAAGTAAGTTGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 5-bp deletion in exon 1.
Proper citation: RRID:RGD_6484562 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=6484564
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2021-11-03)
Alternate IDs: 6484564
Notes: This strain was produced by injecting ZFNs targeting the sequence CTCGCCTGCATCCTTCAAGtgcagtTCCCAGGAGCAGGTAAGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp frameshift deletion in exon 1.
Proper citation: RRID:RGD_6484564 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5686788
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2018-09-05)
Alternate IDs: 5686788
Notes: ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.
Proper citation: RRID:RGD_5686788 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5686306
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 5686306
Notes: ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.
Proper citation: RRID:RGD_5686306 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5686300
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2019-07-26)
Alternate IDs: 5686300
Notes: ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.
Proper citation: RRID:RGD_5686300 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5686784
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2018-09-05)
Alternate IDs: 5686784
Notes: ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.
Proper citation: RRID:RGD_5686784 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5686786
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 5686786
Notes: ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.
Proper citation: RRID:RGD_5686786 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5686780
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 5686780
Notes: ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.
Proper citation: RRID:RGD_5686780 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=6484561
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2017-01-26)
Alternate IDs: 6484561
Notes: This strain was produced by injecting ZFNs targeting the sequence CTGTTCCAGGTCACCATCctcaatGGGGCATCCCAGGATCTT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 14-bp frameshift deletion in exon 4.
Proper citation: RRID:RGD_6484561 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=6484560
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2017-01-26)
Alternate IDs: 6484560
Notes: This strain was produced by injecting ZFNs targeting the sequence CACCACCATCGTGGTtaacaTTTACGAGGATGGTGTCAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 14-bp deletion in exon 5.
Proper citation: RRID:RGD_6484560 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5509991
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2017-01-26)
Alternate IDs: 5509991
Notes: This strain was produced by injecting ZFNs into SS/JrHsdMcwi rat embryos. The resulting mutation is a 49-bp deletion and one G insertion causing frameshift deletion in exon 1.
Proper citation: RRID:RGD_5509991 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5509992
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2017-01-26)
Alternate IDs: 5509992
Notes: This strain was produced by injecting ZFNs targeting the sequence TGCTAGATCAACcactaCCCACGGGTCAGGTA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp frameshift deletion in exon 7.
Proper citation: RRID:RGD_5509992 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5509995
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2017-01-26)
Alternate IDs: 5509995
Notes: This strain was produced by injecting ZFNs targeting the sequence CAGGCATCCCAGGATATCctggtcACAATGGGATACCGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 47-bp frameshift deletion in exon 2.
Proper citation: RRID:RGD_5509995 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5509994
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2021-11-03)
Alternate IDs: 5509994
Notes: This strain was produced by injecting ZFNS targeting the sequence ctcccccatcccacttgaatgtggagcagcctgtg into SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp deletion in exon 7 in SS/JrHsdMcwi.
Proper citation: RRID:RGD_5509994 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5509997
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Extinct
Alternate IDs: 5509997
Notes: This strain was produced by injecting ZFNs targeting the sequence ctctgaaccttcaactttcagatactgatgacaatgaa into SS.BN-(D13Rat20-D13Got22)/Mcwi rat embryos. The resulting mutation is an 11-bp frameshift deletion in exon 6.
Proper citation: RRID:RGD_5509997 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5686776
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 5686776
Notes: ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.
Proper citation: RRID:RGD_5686776 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5686778
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Extinct (as of 2018-09-05)
Alternate IDs: 5686778
Notes: ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.
Proper citation: RRID:RGD_5686778 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.