Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
LEW-Pkd1em2Mcwi Resource Report Resource Website |
RRID:RGD_10054430 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the Pkd1 gene of LEW/NCrl rat embryos. The resulting mutation is a 8-bp deletion in the Pkd1 gene. Contact MCW rat distribution at [email protected] | 10054430 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2017-01-26) | 10054430 | 2026-09-12 01:25:30 | 0 | |||||
|
SS-Casrem1Mcwi Resource Report Resource Website |
RRID:RGD_10054310 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the Casr gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp (T) insertion in the Casr gene. Contact MCW rat distribution at [email protected] | 10054310 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2018-10-22) | 10054310 | 2026-09-12 01:25:30 | 0 | |||||
|
SD-Abcc6em1Qlju-/- Resource Report Resource Website |
RRID:RGD_10413850 | Rattus norvegicus | This strain was produced by injecting ZFNs into SD embryos. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 10-bp deletion (CAGGCCTGAG)from the first coding exon of the rat Abcc6 gene. The mutation is predicted to cause out of frame translation and a premature stop codon. No protein in the homozygous mutant was detected by immunostaining. | 10413850 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 10413850 | 2026-09-12 01:25:31 | 0 | |||||
|
F344-Ldlrm1Kyo/Ta Resource Report Resource Website |
RRID:RGD_8552259 | Rattus norvegicus | Developed by the DEPOSITOR National BioResource Project for the Rat in Japan | 8552259 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Embryo | 8552259 | 2026-09-12 01:25:30 | 0 | |||||
|
SD-Abcc6em3Qlju-/- Resource Report Resource Website |
RRID:RGD_10413854 | Rattus norvegicus | This strain was produced by injecting ZFNs into SD embryos. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 10-bp deletion (CAGGCCTGAG)from the first coding exon of the rat Abcc6 gene. The mutation is predicted to cause out of frame translation and a premature stop codon. No protein in the homozygous mutant was detected by immunostaining. | 10413854 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 10413854 | 2026-09-12 01:25:31 | 0 | |||||
|
LEW-Pkd1em6Mcwi Resource Report Resource Website |
RRID:RGD_10054439 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the Pkd1 gene of LEW/NCrl rat embryos. The resulting mutation is a 8-bp deletion in the Pkd1 gene. Contact MCW rat distribution at [email protected] | 10054439 | mutant | Rat Genome Database (RGD) | RGD | Live Animals; Cryopreserved Sperm (as of 2018-10-22) | 10054439 | 2026-09-12 01:25:30 | 0 | |||||
|
F344-Nfe2l2em2Kyo Resource Report Resource Website |
RRID:RGD_10045600 | Rattus norvegicus | Zinc-finger nucleases (ZFNs) method targeting exon 5 of Nfe2l2 (Nrf2) (ACCACTGTCCCCAGCCCAgaggccACACTGACAGAGATGGAC) was used; This strain has a 1 bp insertion in Nfe2l2 gene. National BioResource Project for the Rat in Japan | 10045600 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 10045600 | 2026-09-12 01:25:31 | 0 | |||||
|
DA-Abcd1em4Mcwi Resource Report Resource Website |
RRID:RGD_10054242 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the Abcd1 gene of DA/OlaHsd rat embryos. Contact MCW rat distribution at [email protected] | 10054242 | mutant | Rat Genome Database (RGD) | RGD | Extinct (as of 2016-10-24) | 10054242 | 2026-09-12 01:25:30 | 0 | |||||
|
WIAR.MPR-Arsbabd/Ncchd Resource Report Resource Website 1+ mentions |
RRID:RGD_8552261 | Rattus norvegicus | Developed by the DEPOSITOR. This congenic strain was established by backcrossing MPR/Iar (RGD:2306064) (provided by Dr. Kunieda, Okayama University) to WIAR/Iar (RGD:2304222) National BioResource Project for the Rat in Japan | 8552261 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Embryo (as of 2023-03-07) | 8552261 | 2026-09-12 01:25:30 | 1 | |||||
|
SS-Adora1em3Mcwi Resource Report Resource Website |
RRID:RGD_10054245 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the Adora1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp deletion in the Adora1 gene. Contact MCW rat distribution at [email protected] | 10054245 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2018-10-22) | 10054245 | 2026-09-12 01:25:30 | 0 | |||||
|
SS-Kcnj10em3Mcwi Resource Report Resource Website |
RRID:RGD_10054411 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the Kcnj10 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 3-bp deletion in the Kcnj10 gene. Contact MCW rat distribution at [email protected] | 10054411 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2018-10-22) | 10054411 | 2026-09-12 01:25:30 | 0 | |||||
|
WI-Foxn1em2Nips Resource Report Resource Website 1+ mentions |
RRID:RGD_10053601 | Rattus norvegicus | Foxn1 mutation was induced by injecting pX330 expressing Cas9 and sgRNA targeting the sequence GACTGGAGGGCGAACCCCAA into Crlj:WI rat embryos. The resulting mutation is a 60-bp frameshift deletion in exon 1 (del 46-105). Section of Mammalian Transgenesis Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, Okazaki Aichi, JAPAN | 10053601 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 10053601 | 2026-09-12 01:25:30 | 1 | |||||
|
SS-Stk39em6Mcwi Resource Report Resource Website |
RRID:RGD_10054465 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the Stk39 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp insertion in the Stk39 gene. Contact MCW rat distribution at [email protected] | 10054465 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2017-01-26) | 10054465 | 2026-09-12 01:25:30 | 0 | |||||
|
WIC-Dmdem1Kykn Resource Report Resource Website |
RRID:RGD_10045593 | Rattus norvegicus | By CRISPR/Cas9 system, mutation was introduced in dystrophin (Dmd) gene of Wistar-Imamichi rat. The resulting mutation is a 329-bp deletion around exon 3 and 2-bp substitution in exon16. National BioResource Project for the Rat in Japan | 10045593 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2016-12-08) | 10045593 | 2026-09-12 01:25:31 | 0 | |||||
|
F344-Nfe2l2em1Kyo Resource Report Resource Website |
RRID:RGD_10045597 | Rattus norvegicus | Zinc-finger nucleases (ZFNs) method targeting exon 5 of Nfe2l2 (Nrf2) (ACCACTGTCCCCAGCCCAgaggccACACTGACAGAGATGGAC) was used; This strain has a 7-bp deletion in Nfe2l2 (Nrf2) gene. National BioResource Project for the Rat in Japan | 10045597 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 10045597 | 2026-09-12 01:25:31 | 0 | |||||
|
WKY-Slc39a12em77Tja-/- Resource Report Resource Website |
RRID:RGD_10401848 | Rattus norvegicus | ZFN mutant founders were backcrossed with WKY/Cruk to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. The resulting mutation 77 has a stop codon, 15 amino acids from the ZFN-binding site, that resulted in a 490 amino acids (54 kDa) truncated protein, 198 amino acids smaller than the WT protein. | 10401848 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 10401848 | 2026-09-12 01:25:30 | 0 | |||||
|
iNP-Npyem6Sage+/-/Iusm Resource Report Resource Website |
RRID:RGD_11531104 | Rattus norvegicus | The heterozygous ZFN mutant rats were produced by backcrossing mutant founders with iNP/Iusm. Genotyping of the offspring was carried out by PCR amplification of a 26-bp deleted fragment, including 6 bp in intron 1 and 20 bp in exon 2. | 11531104 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 11531104 | 2026-09-12 01:25:30 | 0 | |||||
|
iNP-Npyem6Sage-/-/Iusm Resource Report Resource Website |
RRID:RGD_11531106 | Rattus norvegicus | The homozygous Npy mutant rats were produced by intercrossing the heterozygous ZFN mutants (iNP-Npyem6Sage+/- /Iusm) to produce homozygous and heterozygous offspring. Genotype of the homozygous offspring was confirmed by PCR amplification of a 26-bp deleted fragment, including 6 bp in intron 1 and 20 bp in exon 2. | 11531106 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 11531106 | 2026-09-12 01:25:30 | 0 | |||||
|
DA-Abcd1em2Mcwi Resource Report Resource Website |
RRID:RGD_10054239 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a 2-bp insertion mutation in the exon1 of the Abcd1 gene of DA/OlaHsd rat embryos. Contact MCW rat distribution at [email protected] | 10054239 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2018-10-22) | 10054239 | 2026-09-12 01:25:30 | 0 | |||||
|
ZDF-Leprm1Rll Resource Report Resource Website 1+ mentions |
RRID:RGD_9835401 | Rattus norvegicus | The Zucker rats from Charles River (ZDF-Leprfa/Crl) carry the Leprm1Rll allele that has substitution of a nucleotide at 880 (A-C) results in Gln-Pro at position 269 | 9835401 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 9835401 | 2026-09-12 01:25:30 | 1 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.