Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
SS-Alms1em1Mcwi Resource Report Resource Website |
RRID:RGD_5131911 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence CCCGCCTCCGACTCCGCCtccgtcCTCCCGGCACCAGTA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 17-bp frameshift deletion in exon 1. | 5131911 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2017-01-26) | 5131911 | 2026-09-05 06:52:28 | 0 | |||||
|
SS-Aldh2em2Mcwi Resource Report Resource Website |
RRID:RGD_5131912 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence AACGGCAAGCCTTATGtcatcTCCTACCTGGTGGAT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp frameshift deletion in exon 4. | 5131912 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2017-01-26) | 5131912 | 2026-09-05 06:52:28 | 0 | |||||
|
SS-Tgfb1em3Mcwi Resource Report Resource Website 1+ mentions |
RRID:RGD_5131989 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence CTGCTCCCACTCCCGTGGcttctAGTGCTGACGCCCGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 22-bp frameshift deletion in exon 3. | 5131989 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2017-01-26) | 5131989 | 2026-09-05 06:52:28 | 1 | |||||
|
SS-Rasgrp3em1Mcwi Resource Report Resource Website |
RRID:RGD_5131974 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence TTCCCCCACAACACCTAATaagcctGTGGTACCCCTGGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a net insertion of 5-bp frameshift deletion in exon 12. | 5131974 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2017-01-26) | 5131974 | 2026-09-05 06:52:28 | 0 | |||||
|
SS-Ptpn11em1Mcwi Resource Report Resource Website |
RRID:RGD_5131975 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence CTCTCCGTCCGCACTggtgaTGACAAAGGGGAGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 17-bp frameshift deletion in exon 4. | 5131975 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2017-01-26) | 5131975 | 2026-09-05 06:52:28 | 0 | |||||
|
SS-Nox4em1Mcwi Resource Report Resource Website |
RRID:RGD_5131963 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence ggttacagcttctacctatgcaataaggtaagggtc into SS/JrHsdMcwi rat embryos. The resulting mutation is a 5-bp frameshift deletion in exon 7. | 5131963 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2017-01-26) | 5131963 | 2026-09-05 06:52:27 | 0 | |||||
|
SS-Mstnem3Mcwi Resource Report Resource Website |
RRID:RGD_5131964 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence CTTATTCCTTTGCAGCTGActttctAATGCAAGCGGATGGA into SS/JrHsdMcwi rat embryos. The resulting mutation is an 8-bp frameshift deletion in exon 2. | 5131964 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2017-01-26) | 5131964 | 2026-09-05 06:52:27 | 0 | |||||
|
SS-Mthfrem1Mcwi Resource Report Resource Website |
RRID:RGD_5131965 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence CCCCAGCCCCCGATCtgaggGCAGCAGCAGTGGCA into SS/JrHsdMcwi rat embryos. The resulting mutation is an 28-bp frameshift deletion in exon 2. | 5131965 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2017-01-26) | 5131965 | 2026-09-05 06:52:27 | 0 | |||||
|
SS-Plod1em1Mcwi Resource Report Resource Website |
RRID:RGD_5131966 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence CATCGCTGCCGAATCttccagAACCTGGATGGAGCCTTG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 4. | 5131966 | mutant | Rat Genome Database (RGD) | RGD | Cryorecovery (as of 2017-01-26) | 5131966 | 2026-09-05 06:52:27 | 0 | |||||
|
SS-Mas1em1Mcwi Resource Report Resource Website |
RRID:RGD_5131952 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence CCTGGGGACTTCACACCCACccattcCCATAGTGCACTGGGT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 4. | 5131952 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2021-11-03) | 5131952 | 2026-09-05 06:52:28 | 0 | |||||
|
SS-Prokr1em1Mcwi Resource Report Resource Website |
RRID:RGD_5131953 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence CGCCATGACCCTGTGCtatgcCAGGGTGTCCCGAGA into SS/JrHsdMcwi rat embryos. The resulting mutation is an 11-bp frameshift deletion in exon 2. | 5131953 | mutant | Rat Genome Database (RGD) | RGD | Extinct (as of 2017-01-26) | 5131953 | 2026-09-05 06:52:28 | 0 | |||||
|
SS-Mstnem2Mcwi Resource Report Resource Website |
RRID:RGD_5131954 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence CTTATTCCTTTGCAGCTGActttctAATGCAAGCGGATGGA into SS/JrHsdMcwi rat embryos. The resulting mutation is an 18-bp frameshift deletion in exon 2. | 5131954 | mutant | Rat Genome Database (RGD) | RGD | Extinct (as of 2017-01-26) | 5131954 | 2026-09-05 06:52:28 | 0 | |||||
|
SS-Hexim2em4Mcwi Resource Report Resource Website |
RRID:RGD_5144105 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence CAGCCCACTCGGCCCggcctcTCCCCGCGCCCGGAC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 3. | 5144105 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2017-01-26) | 5144105 | 2026-09-05 06:52:27 | 0 | |||||
|
SS-Ldlrem1Mcwi Resource Report Resource Website |
RRID:RGD_5144103 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence TGCATCCCCAGCCTGTGGgcctgcGACGGGGACCGGGAC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp frameshift deletion in exon 4. | 5144103 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2017-01-26) | 5144103 | 2026-09-05 06:52:27 | 0 | |||||
|
ACI.FHH-(D1Mit18-D1Rat90)(D14Mit11-D14Rat33)(D14Rat65-D14Rat90)/EurMcwi-Asipem1Mcwi Resource Report Resource Website |
RRID:RGD_5144102 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence agccacctggtatttgaggagacgcttggagatgac into ACI.FHH(D1Mit18-D1Rat90)(D14Mit11-D14Rat33)(D14Rat65-D14Rat90) embryos. The result is a 5-bp frameshift deletion in exon 2. | 5144102 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2017-01-26) | 5144102 | 2026-09-05 06:52:27 | 0 | |||||
|
SS-Ldlrem4Mcwi Resource Report Resource Website |
RRID:RGD_5144108 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence TGCATCCCCAGCCTGTGGgcctgcGACGGGGACCGGGAC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp frameshift deletion in exon 4. | 5144108 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2017-01-26) | 5144108 | 2026-09-05 06:52:27 | 0 | |||||
|
SS-Kcnq1em14Mcwi Resource Report Resource Website |
RRID:RGD_5144101 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence GTCTGCAGGCTGCCGCagcaagTACGTGGGCATCTGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 17-bp frameshift deletion in exon 3. | 5144101 | mutant | Rat Genome Database (RGD) | RGD | Cryorecovery (as of 2017-01-26) | 5144101 | 2026-09-05 06:52:27 | 0 | |||||
|
BN-Lx/CubPrin Resource Report Resource Website |
RRID:RGD_5131094 | Rattus norvegicus | Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. | 5131094 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 5131094 | 2026-09-05 06:52:27 | 0 | |||||
|
SS-Plcd3em7Mcwi Resource Report Resource Website |
RRID:RGD_5143994 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence GCCCGCGTCATCCGAtagcagCACCAAAAGGCCCGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 142-bp deletion, overlapping the start codon | 5143994 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2017-01-26) | 5143994 | 2026-09-05 06:52:27 | 0 | |||||
|
SS-Agtrapem8Mcwi Resource Report Resource Website |
RRID:RGD_5143996 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence ATCCTGGCCCTGGGTgtgtggGCTGTGGCCCAGCGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 100-bp mutation deleting part of exon 3 and the splice acceptor. | 5143996 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2017-01-26) | 5143996 | 2026-09-05 06:52:28 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
