Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
F344-LargeTn(sb-T2/Bart3)2.336Mcwi Resource Report Resource Website |
RRID:RGD_2313464 | Rattus norvegicus | These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Large gene. | 2313464 | mutant | Rat Genome Database (RGD) | RGD | Extinct (as of 2017-01-26) | 2313464 | 2026-09-05 06:52:25 | 0 | |||||
|
Taiep/Dun Resource Report Resource Website |
RRID:RGD_2317278 | Rattus norvegicus | These mutants were found in Sprague-Dawley rats at University of Puebla in 1989 | 2317278 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 2317278 | 2026-09-05 06:52:26 | 0 | |||||
|
F344-Tmem22Tn(sb-T2/Bart3)2.332Mcwi Resource Report Resource Website |
RRID:RGD_2311693 | Rattus norvegicus | These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Tmem22 gene. | 2311693 | mutant | Rat Genome Database (RGD) | RGD | Extinct (as of 2017-01-26) | 2311693 | 2026-09-05 06:52:25 | 0 | |||||
|
F344-Kmch/NSlc Resource Report Resource Website |
RRID:RGD_4140469 | Rattus norvegicus | from NBRP National BioResource Project for the Rat in Japan | 4140469 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 4140469 | 2026-09-05 06:52:26 | 0 | |||||
|
BCR/Nn Resource Report Resource Website |
RRID:RGD_2314244 | Rattus norvegicus | In the course of producing transgenic rats (DRPLA promoter + huntingtin exon1+EGFP on a Slc:SD background), a mutant rat showing involuntary movements (circling) and symptoms of dystonia was found in F6 progeny. Subsequent by the selection of the involuntary movement segregated the transgene from the phenotype. Thereafter this strain was maintained by only the phenotype (not the transgene). National BioResource Project for the Rat in Japan | 2314244 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm | 2314244 | 2026-09-05 06:52:25 | 0 | |||||
|
SS-Nckap5em1Mcwi Resource Report Resource Website |
RRID:RGD_4139879 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence ctctgaaccttcaactttcagatactgatgacaatgaa into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 6. | 4139879 | mutant | Rat Genome Database (RGD) | RGD | Extinct | 4139879 | 2026-09-05 06:52:26 | 0 | |||||
|
SS-Nckap5em2Mcwi Resource Report Resource Website |
RRID:RGD_4139872 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence ctctgaaccttcaactttcagatactgatgacaatgaa into SS/JrHsdMcwi rat embryos. The resulting mutation is a 4-bp frameshift deletion in exon 6. | 4139872 | mutant | Rat Genome Database (RGD) | RGD | Extinct (as of 2017-01-26) | 4139872 | 2026-09-05 06:52:26 | 0 | |||||
|
SS-Ets1em1Mcwi Resource Report Resource Website |
RRID:RGD_4139874 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence aacccatgtccgggattgggtgatgtgggctgtgaatgag into SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp frameshift deletion in exon 3. | 4139874 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2017-01-26) | 4139874 | 2026-09-05 06:52:26 | 0 | |||||
|
SS-Rag1em2Mcwi Resource Report Resource Website |
RRID:RGD_4139873 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence gtctactgcccaaggaatgtgaccgtggagtggca into SS/JrHsdMcwi rat embryos. The resulting mutation is a 17-bp frameshift deletion in exon1. | 4139873 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2021-11-03) | 4139873 | 2026-09-05 06:52:26 | 0 | |||||
|
FHH-Chr 1BN-Sorcs1em1Mcwi Resource Report Resource Website |
RRID:RGD_4139875 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence ataaacctttcccaggatacattgacccggattct into FHH-Chr 1BN/Mcwi embryos. The resulting mutation is a 14-bp frameshift deletion mutation in exon 20. | 4139875 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2017-01-26) | 4139875 | 2026-09-05 06:52:26 | 0 | |||||
|
SS-Mmp2em2Mcwi Resource Report Resource Website 1+ mentions |
RRID:RGD_4139878 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence aaccacaaccaactacgatgatgaccggaagtggggc into SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp frameshift deletion in exon 7. | 4139878 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2021-11-03) | 4139878 | 2026-09-05 06:52:26 | 1 | |||||
|
FHH.BN-(D1Hmgc14-D1Hmgc15)/Mcwi-Rab38em1Mcwi Resource Report Resource Website |
RRID:RGD_4139877 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence CACCAAAACTTCTCCTCCCACTACCGGGCCACCATTGGT into FHH.BN-(D1Hmgc14-D1Hmgc15)/Mcwi rat embryos. The resulting mutation is a 1-bp frameshift deletion in exon 1. | 4139877 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2017-01-26) | 4139877 | 2026-09-05 06:52:26 | 0 | |||||
|
SS-Nckap5em3Mcwi Resource Report Resource Website |
RRID:RGD_4139881 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence ctctgaaccttcaactttcagatactgatgacaatgaa into SS/JrHsdMcwi rat embryos. The resulting mutation is an 11-bp frameshift deletion in exon 6. | 4139881 | mutant | Rat Genome Database (RGD) | RGD | Extinct (as of 2017-01-26) | 4139881 | 2026-09-05 06:52:26 | 0 | |||||
|
SS-Nppaem4Mcwi Resource Report Resource Website |
RRID:RGD_4139882 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence gcctccgcaggccctgagcgagcagaccgatgaagcgggg into SS/JrHsdMcwi rat embryos. The resulting mutation is a 22-bp frameshift deletion in exon 2. | 4139882 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2021-11-03) | 4139882 | 2026-09-05 06:52:26 | 0 | |||||
|
SS-Rag1em1Mcwi Resource Report Resource Website |
RRID:RGD_4139884 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence gtctactgcccaaggaatgtgaccgtggagtggca into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp frameshift deletion in exon1. | 4139884 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2021-11-03) | 4139884 | 2026-09-05 06:52:26 | 0 | |||||
|
TT/Sgn Resource Report Resource Website |
RRID:RGD_4139890 | Rattus norvegicus | Rats with bilateral small testes were found in a Wistar-Imamichi derived inbred strain in 1986 at the Institute for Animal Reproduction. TT was established from these mutant rats as known as aspermia rats. National BioResource Project for the Rat in Japan | 4139890 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm | 4139890 | 2026-09-05 06:52:26 | 0 | |||||
|
SS-Gpr183em2Mcwi Resource Report Resource Website |
RRID:RGD_5143988 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence CTGCCACTGCTCCtcaaaCCCATGTCTAAGCAGGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 4-bp frameshift deletion in exon 2. | 5143988 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2017-01-26) | 5143988 | 2026-09-05 06:52:27 | 0 | |||||
|
SS-Ulk3em1Mcwi Resource Report Resource Website |
RRID:RGD_5143986 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence CGCTCTACATGGCTCCTGAgatggtGTGTCGGCGGCAGTA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 5. | 5143986 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2017-01-26) | 5143986 | 2026-09-05 06:52:27 | 0 | |||||
|
SS-Cdh13em1Mcwi Resource Report Resource Website |
RRID:RGD_5131922 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence CTCACCCTGTGCGTCctgctgTCCCAGGTAGGGAATG into SS/JrHsdMcwi rat embryos. The resulting mutation is an 8-bp frameshift deletion in exon 1. | 5131922 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2021-11-03) | 5131922 | 2026-09-05 06:52:27 | 0 | |||||
|
SS-Slc30a8em1Mcwi Resource Report Resource Website |
RRID:RGD_5131991 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence TATCACTGCCACAACagcttcAAGGCCACAGGGAACAGGTC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 17-bp frameshift deletion in exon 2. | 5131991 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2017-01-26) | 5131991 | 2026-09-05 06:52:28 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
