Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10402167
Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Unknown
Alternate IDs: 10402167
Notes: LCR/Tol (LCR/Mco) bred till the twenty-sixth generation
Proper citation: RRID:RGD_10402167 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10402160
Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Unknown
Alternate IDs: 10402160
Notes: HCR/Mco bred till the fifth generation
Proper citation: RRID:RGD_10402160 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10043813
Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Cryopreserved Embryo; Cryopreserved Sperm
Alternate IDs: 10043813
Notes: SHR/Kyushu rat (Kyushu University) was delivered to Shimane University in 2000 and maintained as inbred. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_10043813 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=12792939
Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 12792939
Notes: SS/JrHsdMcwi were crossed with SS.BN-(D13Rat151-D13Rat197)/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain
Proper citation: RRID:RGD_12792939 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10402163
Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Unknown
Alternate IDs: 10402163
Notes: HCR/Mco bred till the twenty-sixth generation
Proper citation: RRID:RGD_10402163 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10413852
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 10413852
Notes: This strain was produced by injecting ZFNs into SD embryos. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 23 bp-deletion (TGCGCAGGCCTGAGGGTGAGTCC) from the first coding exon of the rat Abcc6 gene. The mutation is predicted to cause out of frame translation and a premature stop codon. No protein in the homozygous mutant was detected by immunostaining.
Proper citation: RRID:RGD_10413852 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10402852
Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 10402852
Notes: multiple congenic strain was generated by combining the three separate congenic strains
Proper citation: RRID:RGD_10402852 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=12802367
Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 12802367
Notes: SS/JrHsdMcwi were crossed with SS-13BN(D13Rat123-D13Rat101)/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain
Proper citation: RRID:RGD_12802367 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=11040980
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Embryo (as of 2017-05-02)
Alternate IDs: 11040980
Notes: By CRISPR/Cas9 system, mutation was introduced in dystrophin (Dmd) gene of Wistar-Imamichi rat: deletion of exon3 to exon16 National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_11040980 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=12802366
Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 12802366
Notes: SS/JrHsdMcwi were crossed with SS-13BN(D13Rat123-D13Rat101)/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain
Proper citation: RRID:RGD_12802366 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=12802365
Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 12802365
Notes: SS/JrHsdMcwi were crossed with SS-13BN(D13Rat123-D13Rat101)/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain
Proper citation: RRID:RGD_12802365 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10450489
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 10450489
Notes: CRISPR/Cas9 system was used to generate this mutant; sgRNA+Cas9+ plasmid was injected into zygote of SD rat that added a 2a-NpHR-EYFP-2a-ChR2-mcherry-ires-WGA-cre behind the last exon of Bsn Institute of Neuroscience, Chinese Academy of Sciences
Proper citation: RRID:RGD_10450489 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=11040581
Source Database: Rat Genome Database (RGD)
Genetic Background: transgenic
Availability: Cryopreserved Sperm
Alternate IDs: 11040581
Notes: F344/Stm rat BAC clone RNB1-186G14 was microinjected into embryos of Wistar rats. The founder rats were backcrossed to TRM/Kyo rats. BAC vector:pKS145. RNB1-186G14 contains region between 60185236-60354841 of Rat Chr 10 and this region contains Spata22 gene expressed in testes. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_11040581 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10402850
Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 10402850
Notes: double congenic strain was generated by combining the two separate congenic strains
Proper citation: RRID:RGD_10402850 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10413858
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 10413858
Notes: This strain was made by ZFN mutagenesis. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 11-bp deletion from cDNA position 39-49 (CTGCGCAGGCC). The mutation is predicted to cause out of frame translation and a premature stop codon. No protein in the homozygous mutant was detected by immunostaining.
Proper citation: RRID:RGD_10413858 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=12802364
Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 12802364
Notes: SS/JrHsdMcwi were crossed with SS-13BN(D13Rat123-D13Rat101)/Mcwi (RGD:2293145), rats from F1 were intercrossed and genotyped to get the congenic strain
Proper citation: RRID:RGD_12802364 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=11040987
Source Database: Rat Genome Database (RGD)
Genetic Background: transgenic
Availability: Cryopreserved Sperm (as of 2017-04-21)
Alternate IDs: 11040987
Notes: BAC (containing rat Nanog gene) vector was injected into Iar:Wistar-Imamichi rats. The construct is as follows: Venus-IRES-puromycin resistance gene. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_11040987 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10402822
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryorecovery (as of 2017-01-26)
Alternate IDs: 10402822
Notes: This strain was produced by injecting ZFNs targeting the sequence CATGGCTCCGACCCCctctacACCCCGGAACCG into DA/OlaHsd rat embryos. The resulting mutation is a 11-bp frameshift deletion in exon 7.
Proper citation: RRID:RGD_10402822 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=11040936
Source Database: Rat Genome Database (RGD)
Genetic Background: transgenic
Availability: Cryopreserved Sperm
Alternate IDs: 11040936
Notes: CHORI230-9K13 recombinant BAC (Mrs2/EGFP) was introduced into Crlj:Wistar embyos. BAC Tg rats were backcrossed with WTC.DMY-dmy. dmy gene: homozygous, transgene: hemizygous. 4 lines: #15, #39, #92, #131 National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_11040936 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=11041108
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm
Alternate IDs: 11041108
Notes: The Laboratory of Reproductive Toxicology at the Institute of Environmental Toxicology has been maintaining a Wistar derived PD strain of rats. In 1986, 1 female and 2 males exhibiting very short and sparse vibrissae were found in a litter of 7 parented by a pd/pd female and phenotypically normal pd/+ male. In 2008, a male Wistar rat and F56 female were crossed, and obtained heterozygous rats were sib-mated. After that, sib mating between homozygous rats was started. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_11041108 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.