Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=12743627
Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2017-02-10)
Alternate IDs: RGD_12743627, 12743627, RRRC_702, RRRC_0702, RRRC_00702
Notes: inbreeding since 2003, juvenile total cataract developed in cNLH line. cNLH = congenital non-learned helpless. congenital non-learned helpless and congenital learned helpless (cLH)lines were developed from outbred Dpargue-Dawley from Charles River. Rat Resource and Research Center
Proper citation: RRID:RRRC_00702 Copy
http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=11667084
Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2017-01-26)
Alternate IDs: RGD_11667084, 11667084, RRRC_704, RRRC_0704, RRRC_00704
Notes: ENU induced total juvenile cataract in inbred Wistar. Rat Resource and Research Center
Proper citation: RRID:RRRC_00704 Copy
http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=12879386
Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Availability: Cryopreserved Sperm; Cryorecovery (as of 2018-12-04)
Alternate IDs: RGD_12879386, 12879386, RRRC_827, RRRC_0827, RRRC_00827
Notes: The CRISPR/Cas9 genome editing system was used to generate this knock out rat strain with 846- bp deletion in the rat Ghsr gene. The rat strain had Ghsr exon1 deletion in the genome and did not express detectable Ghsr mRNA in brain regions. Optogenetics and Transgenic Technology Core, Rat Resource and Research Center
Proper citation: RRID:RRRC_00827 Copy
http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=11084928
Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2017-01-26)
Alternate IDs: RGD_11084928, 11084928, RRRC_755, RRRC_0755, RRRC_00755
Notes: The mutation was generated using zinc finger nuclease technology. The mutation involves insertion of one extra C at position 16:20486368 in the intronless JunD gene (Rat (Rnor_6.0)Ensembl) resulting in a null mutation. Rat Resource and Research Center
Proper citation: RRID:RRRC_00755 Copy
http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=150521659
Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Availability: Cryopreserved Embryo; Cryopreserved Sperm; Cryorecovery (as of 2021-11-15)
Alternate IDs: RGD_150521659, 150521659, RRRC_922, RRRC_0922, RRRC_00922
Notes: This strain was produced by injecting ZFNs targeting the following sequence CAGGGCAGCCGC-CACtggcaGAAGCTGCGGGAGGA in exon 1 of the rat Dusp5 gene into FHH-Chr 1BN/Mcwi embryos. The resulting mutation is a 14 bp deletion and a 3 bp insertion between nucleotides 449 and 464 in Dusp5 mRNA that creates a frame shift mutation which is predicted to introduce a premature stop codon at amino acid 121. Rat Resource and Research Center
Proper citation: RRID:RRRC_00922 Copy
http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=7257663
Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: RGD_7257663, 7257663, RRRC_694, RRRC_0694, RRRC_00694
Notes: This strain was produced by TALEN mediated 13 bp deletion in Exon 1 in the rat Tlr4 gene; background strain is Crl:WI Rat Resource and Research Center
Proper citation: RRID:RRRC_00694 Copy
http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=329955451
Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Availability: Cryopreserved Embryo; Cryorecovery (as of 2023-07-12)
Alternate IDs: RGD_329955451, 329955451, RRRC_930, RRRC_0930, RRRC_00930
Notes: A CRISPR/cas9 strategy was employed by Sage Labs, to generate Charles River Sprague Dawley rats with a 53 base pair deletion within SerpinA6. The single guide RNA (sgRNA) targeted sequences within exon 2 of SerpinA6, encoding amino acid residues within the amino-terminal region of the mature Serpina6, also known as corticosteroid-binding globulin (CBG) polypeptide. The resulting 53 base pair deletion removed codons for residues Pro40-Thr57, with a frameshift after Ser39, resulting in a unique 14 residue sequence followed by a TGA stop codon. Rat Resource and Research Center
Proper citation: RRID:RRRC_00930 Copy
http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=1642270
Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Availability: Cryopreserved Sperm; Cryorecovery
Alternate IDs: RGD_1642270, 1642270, RRRC_397, RRRC_0397, RRRC_00397
Notes: Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. H316N mutation is generated from the codon change CAC/AAC. Rat Resource & Research Center
Proper citation: RRID:RRRC_00397 Copy
http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=401795484
Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2023-09-11)
Alternate IDs: RGD_401795484, 401795484, RRRC_996, RRRC_0996, RRRC_00996
Notes: Exon 1 of Slc30a10 was targeted using CRISPR/Cas9 in the Crl:CD(SD) embryos . A mosiac founder that transmitted a 248 bp deletion in exon 1 of Slc30a10 leading to an out of frame mutation after amino acid 22 was bred to a CD rat to select for the above deletion and establish the line. The strain will be deposited to Rat Resource and Research Center
Proper citation: RRID:RRRC_00996 Copy
http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=329951705
Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Availability: Cryopreserved Sperm; Cryorecovery (as of 2023-07-10)
Alternate IDs: RGD_329951705, 329951705, RRRC_807, RRRC_0807, RRRC_00807
Notes: Deletion of coding sequence (Exon 2) using CRISPR/Cas9 Rat Resource and Research Center
Proper citation: RRID:RRRC_00807 Copy
http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=329951706
Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Availability: Cryopreserved Embryo; Cryopreserved Sperm; Cryorecovery (as of 2023-07-10)
Alternate IDs: RGD_329951706, 329951706, RRRC_861, RRRC_0861, RRRC_00861
Notes: CRISPR/Cas9-mediated deletion of ATG start site in Exon 2 of Adrm1 gene Rat Resource and Research Center
Proper citation: RRID:RRRC_00861 Copy
http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=155900755
Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Availability: Cryopreserved Embryo; Cryopreserved Sperm (as of 2023-02-09)
Alternate IDs: RGD_155900755, 155900755, RRRC_984, RRRC_0984, RRRC_00984
Notes: Using CRISPR/Cas9 genomic engineering in rats via homologous end-joining in fertilized embryos, we have knocked'in a humanized CHRNA6 3'UTR in place of the natural CHRNA6 3'UTR of the Sprague Dawley rat line. This new genetically modified CHRNA6C123G humanized rat line carries a homozygous GG nucleotide modification at position 123 within the CHRNA6 gene 3'UTR. The laboratory has deposited these strains with the Rat Resource and Research Center
Proper citation: RRID:RRRC_00984 Copy
http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=2306711
Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Availability: Cryopreserved Sperm
Alternate IDs: RGD_2306711, 2306711, RRRC_475, RRRC_0475, RRRC_00475
Notes: this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb Rat Resource & Research Center
Proper citation: RRID:RRRC_00475 Copy
http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=401827145
Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Availability: Cryorecovery (as of 2025-01-27)
Alternate IDs: RGD_401827145, 401827145, RRRC_1007, RRRC_01007
Notes: The CRISPR-Cas9 system was used to delete the coding region (exons 1-8) of the Pink1 gene in NTac:SD embryos. The rat is deposited at Rat Resource and Research Center (RRRC).
Rat Resource and Research Center
Proper citation: RRID:RRRC_01007 Copy
http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=151356946
Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: RGD_151356946, 151356946, RRRC_953, RRRC_0953, RRRC_00953
Notes: Two DNA expression constructs, the bacterial tetracyclin repressor (TetR) under the expression control of human EEF1A1 promoter and the improved Cre recombinase (iCre) under Fos promoter were joined in an antiparallel orientation in one rat ROSA26 targeting cassette. ROSA26 is a synonym for rat Thumpd3-as1 (RGD:6491660) and is used as an official symbol for rat strain nomenclature. The DNA construct, together with CRISPR /Cas9 system, was injected to one cell Long-Evans (Crl:LE) rat embryos and founders were identified and bred for 8 generations at at NIDA IRP (Hope lab). Rat Resource and Research Center
Proper citation: RRID:RRRC_00953 Copy
http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=13602097
Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: RGD_13602097, 13602097, RRRC_834, RRRC_0834, RRRC_00834
Notes: This mutant strain was created using highly efficient CRISPR-Cas9-mediated homology-directed repair (HDR) in rat spermatogonial stem cell cultures. The CRISPR/Case9 knock-in rats have cre recombinase-dependent expression of CRISPR associated protein 9 (Cas9) catalytic mutant protein D10A under the control of CAG promoter inserted to the rat ROSA26 locus. ROSA26 is a synonym for rat Thumpd3-as1 (RGD:6491660) and is used as an official symbol for rat strain nomenclature.The resulting mutant rats in Prague-Dawley background was backcrossed with WT LE for three or four generations for studies. Rat Resource and Research Center
Proper citation: RRID:RRRC_00834 Copy
http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=405855876
Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: RGD_405855876, 405855876, RRRC_957, RRRC_0957, RRRC_00957
Notes: This Foxo4 mutant strain was created in zygotes from Holtzman Sprague-Dawley. Guided RNAs targeting exon 2 (target sequence: CCAGATATACGAATGGATGGTCC; nucleotides 517-539) and exon 3 (target sequence: GTTCATCAAGGTACATAACGAGG; nucleotides 631-653) of the Foxo4 gene (NM_001106943.1)) were injected to the embryos to create a 3096-bp deletion including the 3' part of exon 2 and 5' part of exon 3, and resulting a premature stop of the protein. Rat Resource and Research Center
Proper citation: RRID:RRRC_00957 Copy
http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=152999003
Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: RGD_152999003, 152999003, RRRC_960, RRRC_0960, RRRC_00960
Notes: Exon 4 of the rat Fxn gene was targeted for homologous recombination to introduce loxP sites using CRISPR/Cas9 Rat Resource and Research Center
Proper citation: RRID:RRRC_00960 Copy
http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=155782907
Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Availability: Cryopreserved Sperm; Cryorecovery (as of 2025-05-13)
Alternate IDs: RGD_155782907, 155782907, RRRC_964, RRRC_0964, RRRC_00964
Notes: Exons 2 and 3 were deleted to eliminate all known Synaptopodin isoforms in rat by CRISPR/Cas9 system in the outbred LE embryos. It is similar to RRRC strain #1025 (LE-Synpoem2Kmh) (RGD:616335891), has a different mutation. This strain is deposited at Rat Resource and Research Center,
Proper citation: RRID:RRRC_00964 Copy
http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=152999023
Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Availability: Cryopreserved Embryo; Cryopreserved Sperm (as of 2024-05-21)
Alternate IDs: RGD_152999023, 152999023, RRRC_965, RRRC_0965, RRRC_00965
Notes: Applied StemCell, Inc (Milpitas, CA) was contracted to generate the Iba1-EGFP knock-in rat model using
CRISPR/Cas9 technology in the Sprague Dawley rat strain. The donor construct inserted consisted of the
EGFP coding sequence (minus the first ATG), followed by the 22 amino acid sequence of the porcine
teschovirus-1 2A (P2A) self-cleaving peptide, and then the first exon of the rat Iba1 gene immediately
downstream of the translational start site. Guide RNA with the following sequence: 5'- TACCCTGCAAATCCTTGCTCTGG-3' targeting the Iba1 gene just
downstream of the translational start site were used. Rat Resource and Research Center
Proper citation: RRID:RRRC_00965 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
