Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Background:mutant (facet)

Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

1,464 Results - per page

Show More Columns | Download Top 1000 Results

Organism Name Proper Citation Species Synonyms Notes Phenotype Affected Gene Genomic Alteration Catalog Number Background Database Database Abbreviation Availability Source References Alternate IDs Record Last Update Mentions Count
SD-Ctnsem1Odev
 
Resource Report
Resource Website
RRID:RGD_401938653 Rattus norvegicus The Ctns gen was deleted by oocyte injection of the CRISPER/Cas9 system (PolyGene AG, Zurich,Switzer-land). Two single guideRNAs(sgRNAs) targeting exon3 of Ctns were selected :CRISPR1a: ACCAACGTCAGCATTAC-CCT(TGG), CRISPR1b: CCATTTACCAGCTTCACAGT(GGG). This Ctns rat line harboring a deletion of 12bp and insertion of 8bp resultingin a premature stop codon in the exon3 of Ctns. Contact Olivier Devuyst at Email: [email protected], National BioResource Project for the Rat in Japan 401938653 mutant Rat Genome Database (RGD) RGD Live Animals (as of 2025-03-31) 401938653 2026-09-12 01:25:41 0
WKY-P2rx7em1Tja
 
Resource Report
Resource Website
RRID:RGD_329955459 Rattus norvegicus A global P2RX7KO on a WKYbackground was created at Imperial College London using zinc finger nuclease (ZFN) technology to generate a 2 base pair insertion in exon 10 of P2rx7 329955459 mutant Rat Genome Database (RGD) RGD Unknown 329955459 2026-09-12 01:25:41 0
SS-Mmp2em1Mcwi
 
Resource Report
Resource Website
RRID:RGD_4139876 Rattus norvegicus This strain was produced by injecting ZFNs targeting the sequence aaccacaaccaactacgatgatgaccggaagtggggc into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 7. (null) (null) 4139876 mutant Rat Genome Database (RGD) RGD Extinct (as of 2017-01-26) 4139876 2026-09-12 01:25:41 0
SD-Mir500 em1Cgen
 
Resource Report
Resource Website
RRID:RGD_405850241 Rattus norvegicus Sprague Dawley rats by microinjection of TALENs in fertilized eggs (Cyagen Biosciences). Briefly, the rno-mir-500 gene (Gene ID: 100314112; MirBase accession no. MIMAT0005321), which was located on rat chromosome X, was selected as the TALEN target site. TALENs were constructed using the Golden Gate Assembly and confirmed by sequencing. The founder, which carried 8- bp deletion (GCACCTGG) in the both strands compared with the wild-type (WT) DNA sequence, were genotyped by PCR followed by DNA-sequencing analysis. After that, heterozygous F1 were produced by mating F0 with WT rats. Heterozygous F1 rats were determined and mated to produce homozygote mutant (mir-500−/−) and WT (mir-500+/+). 405850241 mutant Rat Genome Database (RGD) RGD Unknown 405850241 2026-09-12 01:25:41 0
LE-Pink1em1Davis
 
Resource Report
Resource Website
RRID:RGD_401827145 Rattus norvegicus The CRISPR-Cas9 system was used to delete the coding region (exons 1-8) of the Pink1 gene in NTac:SD embryos. The rat is deposited at Rat Resource and Research Center (RRRC). Rat Resource and Research Center 401827145 mutant Rat Genome Database (RGD) RGD Cryorecovery (as of 2025-01-27) 401827145 2026-09-12 01:25:41 0
WKY-Col4a5em2Matsu
 
Resource Report
Resource Website
RRID:RGD_329845599 Rattus norvegicus Genome editing was performed using the rGONAD method to produce three different lines of KO rats due to three different genome mutations thus different in protein expression predication. The genetic background is WKY/NCrlCrlj (Charles River Laboratories Japan) (RGD:61119). Tandem STOP codons were designed to integrate into 27 bases after the first ATG in the rat Col4a5 gene This em2 mutant carries a premature stop coden after 15 amino acids due to insertion of a 42bp stop codon. Col4α5 em2 rats have urinary protein and hematuria from early on, and males begin to die at 18 weeks of age and all die by 28 weeks of age. National BioResource Project for the Rat in Japan 329845599 mutant Rat Genome Database (RGD) RGD Unknown 329845599 2026-09-12 01:25:41 0
SD-Ahrem1Iexas+/+
 
Resource Report
Resource Website
RRID:RGD_401940198 Rattus norvegicus The Ahr wild type littermates from the cross of heterozygous Ahr rats. The Ahr mutants were created using CRISPR/Cas9 gene editing to delete a portion of exon 2 of Ahr in Sprague Dawley rats . 401940198 mutant Rat Genome Database (RGD) RGD Unknown 401940198 2026-09-12 01:25:41 0
WKY-Col4a5em1Matsu
 
Resource Report
Resource Website
RRID:RGD_329845597 Rattus norvegicus Genome editing was performed using the rGONAD method to produce three different lines of KO rats due to three different genome mutations thus different in protein expression predication. The genetic background is WKY/NCrlCrlj (Charles River Laboratories Japan) (RGD:61119). Tandem STOP codons were designed to integrate into 27 bases after the first ATG in the rat Col4a5 gene This em1 mutant carries a premature stop coden after 9 amino acids due to the insertion of a 20 bp stop codon. Col4a5 KO rats have urinary protein and hematuria from early on, and males begin to die at 18 weeks of age and all die by 28 weeks of age. National BioResource Project for the Rat in Japan 329845597 mutant Rat Genome Database (RGD) RGD Cryopreserved Embryo (as of 2023-05-30) 329845597 2026-09-12 01:25:41 0
CD-Ctnsem2Vjupk
 
Resource Report
Resource Website
RRID:RGD_155630631 Rattus norvegicus The mutant rat was produced by injecting Crl:CD(SD) zygotes with gRNA +Cas9 ribonucleoprotein complex targeting exon 3 of rat Ctns. The founder of this strain possessed a 2-bp insertion which results in frameshift and pre-mature stop truncated protein. 155630631 mutant Rat Genome Database (RGD) RGD Unknown 155630631 2026-09-12 01:25:41 0
SD-Esr1em1Bra-/-
 
Resource Report
Resource Website
1+ mentions
RRID:RGD_405649860 Rattus norvegicus Two target sequences (GCCGTGTTCAACTACCCCGAGGG and GCTGCGCAAGTGTTACGAAGTGG) within the second and third exon, respectively, of the coding sequence of Esr1 (the rat gene encoding ERα) were selected. gRNAs targeting these sequences were synthesized via in vitro transcription. gRNAs (25 ng/ul each) were co- microinjected with Cas9 protein (40 ng/ul) into Sprague-Dawley rat embryos, and embryos were transferred into pseudo-pregnant recipients. Animals heterozygous for a 25 base pair deletion in Esr1 exon 3 were used to establish an ER alpha mutant colony and subsequent homozygous mutant offspring were obtained for study. Department of Medicine, Division of Pulmonary, Critical Care, Sleep and Occupational Medicine, Indiana University School of Medicine, Indianapolis, Indiana, USA. 405649860 mutant Rat Genome Database (RGD) RGD Unknown 405649860 2026-09-12 01:25:41 1
W;WIAR-Izumo1em1Osb
 
Resource Report
Resource Website
RRID:RGD_329845586 Rattus norvegicus Izumo1 KO strain was established by CRISPR/Cas9 system using inbred WIAR (RGD:2304222) (SLC, Inc.). sgRNA:GGTGGCTGCAATAAAGACTT, PAM sequence:TGG. A 7-bp deletion(CTTTGGA)after start codon (Met) in exon2 of Izumo1 gene was detected. After establishment of WIAR background KO rats, this strain was mated with Slc:Wistar (RGD:2314928), hence this mutant is in mix background.Izumo1-deficient male rats are infertile. In female rats, no specific phenotype is observed. National BioResource Project for the Rat in Japan 329845586 mutant Rat Genome Database (RGD) RGD Cryopreserved Sperm (as of 2023-12-28) 329845586 2026-09-12 01:25:41 0
SD-Ace2em1(ACE2)Prem
 
Resource Report
Resource Website
RRID:RGD_329955557 Rattus norvegicus CRISPR/Cas9 knock-in of the human ACE2 transgene into the endogenous locus of the rat Ace2 gene. Single integration of hACE2, with expression driven by the endogenous rat Ace2 promoter. Provides a more natural expression pattern (versus abundant overexpression as seen in prior models). Deposited this strain with the Rat Resource and Research Center: (RRRC), 4011 Discovery Drive, Columbia, MO 65201. Phone: (573) 884-6076 Fax: 573-882-9857 329955557 mutant Rat Genome Database (RGD) RGD Live Animals (as of 2023-07-17) 329955557 2026-09-12 01:25:41 0
WKY-Krtcap3em3Mcwi+/+
 
Resource Report
Resource Website
RRID:RGD_405849411 Rattus norvegicus CRISPR/Cas9 system was used to introduce a mutation in the Krtcap3 gene of WKY/Ncrlrat embryos. This is the wild type littermate (from heterozygous breeders) carrying wild type Krtcap3. This wild type mutant usually is used as an experimental control. Contact MCW rat distribution at [email protected] 405849411 mutant Rat Genome Database (RGD) RGD Unknown 405849411 2026-09-12 01:25:41 0
SS-Mmp2em1Mcwi-/-
 
Resource Report
Resource Website
RRID:RGD_5688030 Rattus norvegicus ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offspring which were intercrossed and offspring maintained as homozygous and heterozygous breeders. (null) (null) 5688030 mutant Rat Genome Database (RGD) RGD Unknown 5688030 2026-09-12 01:25:41 0
SD-Trim44em1Lizh,Tg(Myh6-cre)Lizh
 
Resource Report
Resource Website
RRID:RGD_329969885 Rattus norvegicus The conditional Trim44 knockout (Trim44 cKO, SD-Trim44em1Lizh, RGD:329969883) was bred with the α-MHC-Cre tool rat (SD-Tg(Myh6-cre)Lizh, RGD:329969882) to generate cardiac-specific Trim44 knockout which had the Trim44flox/flox/α-MHC-Cre genotype. 329969885 mutant Rat Genome Database (RGD) RGD Unknown 329969885 2026-09-12 01:25:41 0
WI-Nanos3em1(tdTomato)Nips
 
Resource Report
Resource Website
RRID:RGD_401795481 Rattus norvegicus The targeting vector was designed to replace the stop codon of Nanos3 with T2A-2xtdTomato. The adeno-associated virus carrying the targeting vector was infected to Crlj:WI (RGD ID: 2312504) rat 1 cell zygotes followed by the introduction of CRISPR/Cas9 ribonucleoprotein complex by electroporation. After incubation overnight, the zygotes were transferred into oviducts of pseudo-pregnant rats. The pups were judged correct gene-targeting by genomic PCR. These rat strains are being maintained by crossing the founder rats with Crlj:WI rats. The tdTomato fluorescence faithfully label Nanos3 expressing cells. Section of Mammalian Transgenesis Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, Okazaki Aichi 444-8787, Japan. or Division of Mammalian Embryology, Center for Stem Cell Biology and Regenerative Medicine, The Institute for Medical Science, The University of Tokyo, Tokyo108-8639, Japan. 401795481 mutant Rat Genome Database (RGD) RGD Cryopreserved Embryo; Cryopreserved Sperm (as of 2023-09-11) 401795481 2026-09-12 01:25:41 0
F344-Hspa8m1Kyo
 
Resource Report
Resource Website
RRID:RGD_598092575 Rattus norvegicus This strain, called KK rats, in homozygous rats show gait abnormalities from around 5-6 weeks of age. Thereafter, the neurological symptoms progress rapidly, leading to emaciation and death. The mutant gene was named kk, as Kenta Kumafuji was the discoverer of the gait abnormality. National BioResource Project for the Rat in Japan 598092575 mutant Rat Genome Database (RGD) RGD Cryopreserved Embryo (as of 2025-03-27) 598092575 2026-09-12 01:25:42 0
SD-Lgals3em1Dfult
 
Resource Report
Resource Website
RRID:RGD_598092509 Rattus norvegicus Gal-3 KO rats were developed using CRISPR technology on the Sprague-Dawley background (Sage). CRISPR guides were selected targeting the fifth exon, and gene disruption was confirmed by genomic sequencing and immunoblot analysis for Gal-3 protein expression in lung tissue. PMCID: PMC6589585 Availability Contact Email: [email protected] at Augusta University 598092509 mutant Rat Genome Database (RGD) RGD Live Animals; Cryopreserved Sperm (as of 2025-03-21) 598092509 2026-09-12 01:25:43 0
LE-Sstem1(cre)Bfdi
 
Resource Report
Resource Website
RRID:RGD_598092583 Rattus norvegicus Cre was inserted at the start codon (methionine) of the somatostatin (Sst) gene. The Sst precursor is then expressed using the T2A peptide as a linker. Genetic background is Iar:Long-Evans (Institute for Animal Reproduction). National BioResource Project for the Rat in Japan 598092583 mutant Rat Genome Database (RGD) RGD Cryopreserved Sperm (as of 2025-03-27) 598092583 2026-09-12 01:25:42 0
SD.LIS-Actbtm1(CAG-GCaMP8)Ksak
 
Resource Report
Resource Website
RRID:RGD_598092585 Rattus norvegicus The ES cell line derived from Lister Hooded rats (Seac:LIS), which was established by Prof. Sakimura at Department of Animal Model Development, Brain Research Institute, Niigata University, was used. Cloned ES cells established by introducing a vector of G8CaMP-flox stop at the 3'non-coding site of the Actb gene were injected into fertilized eggs of SD rats (Slc:SD) using a microinjection method. National BioResource Project for the Rat in Japan 598092585 mutant Rat Genome Database (RGD) RGD Cryopreserved Sperm (as of 2025-03-27) 598092585 2026-09-12 01:25:42 0

Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.