Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00051836
Source Database: WormBase (WB)
Affected Genes: WBGene00001864(him-5)
Genomic Alteration: WBGene00001864(him-5)
Availability: unknown
Source References: EMPTY
Synonyms: him-5(e1490)V; otIs518; otIs773.
Notes: otIs518 [eat-4(fosmid)::SL2::mCherry::H2B + pha-1(+)]. otIs773 [inx-19(fosmid)::SL2::YFP::H2B + unc-122::GFP + pha-1(+)]. Integrated fosmid transcriptional reporter for inx-19.
Proper citation: RRID:WB-STRAIN:WBStrain00051836 Copy
http://www.wormbase.org/db/get?name=WBStrain00051835
Source Database: WormBase (WB)
Affected Genes: WBGene00001867(him-8)|WBGene00020136(nlp-45)
Genomic Alteration: WBGene00001867(him-8), WBGene00020136(nlp-45)
Availability: unknown
Source References: EMPTY
Synonyms: him-8(e1489) IV; nlp-45(ot1032[nlp-45::T2A::GFP::H2B]) X; otEx7578.
Notes: otEx7578 [rab-3p::fem-3::SL2::TagRFP + inx-6(prom18)::TagRFP]. Panneuronal overexpression of fem-3 causes panneuronal masculation. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.
Proper citation: RRID:WB-STRAIN:WBStrain00051835 Copy
http://www.wormbase.org/db/get?name=WBStrain00051782
Source Database: WormBase (WB)
Affected Genes: WBGene00000898(daf-2)|WBGene00006843(unc-119)
Genomic Alteration: WBGene00000898(daf-2), WBGene00006843(unc-119)
Availability: unknown
Source References: EMPTY
Synonyms: hqSi11 II; daf-2(hq363[daf-2::degron::mNeonGreen]) unc-119(ed3) III.
Notes: hqSi11 [lim-7p::TIR1::mRuby::unc-54 3' UTR + Cbr-unc-119(+)] II. Degron and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. hqSi11 was generated by replacing the eft-3 promoter of the ieSi57 insertion (oxTi179 site) with the lim-7 promoter using CRISPR/Cas9. This strain can be used for auxin-inducible degradation (AID) of DAF-2 protein in the gonadal sheath. hqSi11 previously known as hq378. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https:|"Made_by: Yan-Ping Zhang, Wen-Hong Zhang"
Proper citation: RRID:WB-STRAIN:WBStrain00051782 Copy
http://www.wormbase.org/db/get?name=WBStrain00051781
Source Database: WormBase (WB)
Affected Genes: WBGene00000898(daf-2)|WBGene00006843(unc-119)
Genomic Alteration: WBGene00000898(daf-2), WBGene00006843(unc-119)
Availability: unknown
Source References: EMPTY
Synonyms: hqSi10 II; daf-2(hq363[daf-2::degron::mNeonGreen]) unc-119(ed3) III.
Notes: hqSi10 [myo-3p::TIR1::mRuby::unc-54 3' UTR + Cbr-unc-119(+)] II. Degron and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. hqSi10 was generated by replacing the eft-3 promoter of the ieSi57 insertion (oxTi179 site) with the myo-3 promoter using CRISPR/Cas9. This strain can be used for auxin-inducible degradation (AID) of DAF-2 protein in the body wall muscles. hqSi10 previously known as hq375. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https:|"Made_by: Yan-Ping Zhang, Wen-Hong Zhang"
Proper citation: RRID:WB-STRAIN:WBStrain00051781 Copy
http://www.wormbase.org/db/get?name=WBStrain00051780
Source Database: WormBase (WB)
Affected Genes: WBGene00000898(daf-2)|WBGene00006843(unc-119)
Genomic Alteration: WBGene00000898(daf-2), WBGene00006843(unc-119)
Availability: unknown
Source References: EMPTY
Synonyms: hqSi9 II; daf-2(hq363[daf-2::degron::mNeonGreen]) unc-119(ed3) III.
Notes: hqSi9 [dpy-7p::TIR1::mRuby::unc-54 3UTR + Cbr-unc-119(+)] II. Degron and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. hqSi9 was generated by replacing the eft-3 promoter of the ieSi57 insertion (oxTi179 site) with the dpy-7 promoter using CRISPR/Cas9. This strain can be used for auxin-inducible degradation (AID) of DAF-2 protein in the hypodermis. hqSi9 previously known as hq374. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https:|"Made_by: Yan-Ping Zhang, Wen-Hong Zhang"
Proper citation: RRID:WB-STRAIN:WBStrain00051780 Copy
http://www.wormbase.org/db/get?name=WBStrain00051786
Source Database: WormBase (WB)
Affected Genes: WBGene00000898(daf-2)|WBGene00006843(unc-119)
Genomic Alteration: WBGene00000898(daf-2), WBGene00006843(unc-119)
Availability: unknown
Source References: EMPTY
Synonyms: ieSi57 II; daf-2(hq363[daf-2::degron::mNeonGreen]) unc-119(ed3) III.
Notes: ieSi57 [eft-3p::TIR1::mRuby::unc-54 3' UTR + Cbr-unc-119(+)] II. Degron and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. A single copy transgene was inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. This strain can be used for auxin-inducible degradation (AID) of DAF-2 protein in somatic tissues. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https:|"Made_by: Yan-Ping Zhang, Wen-Hong Zhang"
Proper citation: RRID:WB-STRAIN:WBStrain00051786 Copy
http://www.wormbase.org/db/get?name=WBStrain00051823
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: otIs763.
Notes: otIs763 [lin-4(fosmid)::NLS::YFP::H2B]. Integrated fosmid transcriptional reporter for lin-4 microRNA. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.
Proper citation: RRID:WB-STRAIN:WBStrain00051823 Copy
http://www.wormbase.org/db/get?name=WBStrain00051789
Source Database: WormBase (WB)
Affected Genes: WBGene00000898(daf-2)|WBGene00000912(daf-16)|WBGene00006843(unc-119)
Genomic Alteration: WBGene00000898(daf-2), WBGene00000912(daf-16), WBGene00006843(unc-119)
Availability: unknown
Source References: EMPTY
Synonyms: daf-16(hq389[daf-16::gfp::degron]) I; hqSi8 II; daf-2(e1370) unc-119(ed3) III.
Notes: hqSi8 [rgef-1p::TIR1::mRuby::unc-54 3UTR+Cbr-unc-119(+)] II. Maintain at 15C. GFP tag and degron inserted at the 3' end of the endogenous daf-16 gene locus by CRISPR/Cas9 engineering. hqSi8 was generated by replacing the eft-3 promoter of the ieSi57 insertion (oxTi179 site) with the rgef-1 promoter using CRISPR/Cas9. This strain can be used for auxin-inducible degradation (AID) of DAF-16 protein in the neurons. hqSi8 previously known as hq373. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https:|"Made_by: Yan-Ping Zhang, Wen-Hong Zhang"
Proper citation: RRID:WB-STRAIN:WBStrain00051789 Copy
http://www.wormbase.org/db/get?name=WBStrain00051821
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: otIs748 X.
Notes: otIs748 [rab-3p(prom1)::GFP + ttx-3p::mCherry] X. Pan-neuronal cytoplasmic GFP expression. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341
Proper citation: RRID:WB-STRAIN:WBStrain00051821 Copy
http://www.wormbase.org/db/get?name=WBStrain00051787
Source Database: WormBase (WB)
Affected Genes: WBGene00000898(daf-2)|WBGene00000912(daf-16)
Genomic Alteration: WBGene00000898(daf-2), WBGene00000912(daf-16)
Availability: unknown
Source References: EMPTY
Synonyms: daf-16(hq389[daf-16::gfp::degron]) I; daf-2(e1370) III.
Notes: Made_by: Yan-Ping Zhang, Wen-Hong Zhang|"Maintain at 15C. GFP tag and degron inserted at the 3' end of the endogenous daf-16 gene locus by CRISPR/Cas9 engineering. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https:"
Proper citation: RRID:WB-STRAIN:WBStrain00051787 Copy
http://www.wormbase.org/db/get?name=WBStrain00051820
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: otIs653.
Notes: Made_by: Maryam Majeed|"otIs653 [srg-8p::mCherry + cho-1p::mCherry + srg-8p::nlg-1::spGFP1-10 + cho-1p::nlg-1::spGFP11]. GRASP labeling of ASK to AIA synapses. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341"
Proper citation: RRID:WB-STRAIN:WBStrain00051820 Copy
http://www.wormbase.org/db/get?name=WBStrain00051825
Source Database: WormBase (WB)
Affected Genes: WBGene00020136(nlp-45)
Genomic Alteration: WBGene00020136(nlp-45)
Availability: unknown
Source References: EMPTY
Synonyms: nlp-45(ot1047) X.
Notes: Presumed null allele nlp-45. ot1047 deletion causes a frameshift resulting in a shortened coding sequence that doesn't include mature neuropeptide. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.
Proper citation: RRID:WB-STRAIN:WBStrain00051825 Copy
http://www.wormbase.org/db/get?name=WBStrain00051824
Source Database: WormBase (WB)
Affected Genes: WBGene00020136(nlp-45)
Genomic Alteration: WBGene00020136(nlp-45)
Availability: unknown
Source References: EMPTY
Synonyms: nlp-45(ot1046) X.
Notes: Presumed null allele nlp-45. ot1046 deletion causes a frameshift resulting in a shortened coding sequence that doesn't include mature neuropeptide. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.
Proper citation: RRID:WB-STRAIN:WBStrain00051824 Copy
http://www.wormbase.org/db/get?name=WBStrain00051828
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: otIs794.
Notes: Made_by: Cyril Cros and Molly Reilly|"otIs794 [cho-1(fosmid)::NLS::SL2::YFP::H2B + eat-4(fosmid)::SL2::LSSmOrange::H2B + unc-47p::tagBFP2 + cat-1p::mMaroon + rab-3p1::2xNLS::tagRFP]. cho-1 fosmid reporter construct labels cholinergic neurons. eat-4 fosmid reporter construct labels glutamatergic neurons. unc-47p::tagBFP2 reporter (contains -2778 to -1 promoter region) labels GABAergic neurons. cat-1p::mMaroon reporter (contains -1599 to -1) labels monoaminergic neurons. rab-3p::tagRFP (contains -1462 to +2921 of prom1) labels all neurons (pan-neuronal marker). Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341"
Proper citation: RRID:WB-STRAIN:WBStrain00051828 Copy
http://www.wormbase.org/db/get?name=WBStrain00051892
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: T13C5.10(ve753[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X.
Notes: Homozygous viable. Deletion of 1497 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gtcacgtaaaattttcaaaatggttgacca ; Right flanking sequence: AGGATAAtaaaaaatcgtattttaaatgct. sgRNA #1: tatgtacacctgccccaaaa; sgRNA #2: ACGTGCCAATCAGTAGTGTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00051892 Copy
http://www.wormbase.org/db/get?name=WBStrain00051896
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: +/nT1[umnIs49] IV; F53F4.11(ve761[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V.
Notes: Made_by: RG KO Group|"umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous early larval lethal. Deletion of 1620 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate dead larvae (ve761 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: CATGCACAGTTGGGAACAGTACAGACTGAT ; Right flanking sequence: AGGAGCAACTGACTTCACAACCTGCAGCTC. sgRNA #1: CGGTATCTTCCTTGAGAACA; sgRNA #2: TTCTTCGCAACTTCAACTGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."
Proper citation: RRID:WB-STRAIN:WBStrain00051896 Copy
http://www.wormbase.org/db/get?name=WBStrain00051895
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00019003(tmed-3)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00019003(tmed-3)
Availability: unknown
Source References: EMPTY
Synonyms: tmed-3(ve760[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I.
Notes: Homozygous viable. Deletion of 725 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ttgaaaatcgtagaaactgtaataatttga ; Right flanking sequence: tcctccctttgatacatagcataagaatat. sgRNA #1: taatttcagGTTGTTACTGG; sgRNA #2: aaaggggcaaaacaactgac. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00051895 Copy
http://www.wormbase.org/db/get?name=WBStrain00051893
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: F35H12.5(ve755[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X.
Notes: Homozygous viable. Deletion of 1604 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tcagATGTTTTCTTCACGTCATATTTTATC ; Right flanking sequence: GATTCTATTTTTGATGCTGACAAAGAAGTC. sgRNA #1: AAACGTTCGTCCAATAATAA; sgRNA #2: CACAACTTCTACAATAAACT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00051893 Copy
http://www.wormbase.org/db/get?name=WBStrain00051932
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: Y53F4B.3(st12270[Y53F4B.3::TY1::EGFP::3xFLAG]) II.
Notes: eGFP and 3xFLAG tags inserted into endogenous locus by CRISPR/Cas9.|"Made_by: DKV/LS/CK"
Proper citation: RRID:WB-STRAIN:WBStrain00051932 Copy
http://www.wormbase.org/db/get?name=WBStrain00051898
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00013128(dxbp-1)
Genomic Alteration: WBGene00000254(bli-4), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00013128(dxbp-1)
Availability: unknown
Source References: EMPTY
Synonyms: dxbp-1(gk5666[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III.
Notes: Made_by: Morgan Zaic|"umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5666 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VC4596 and CGC92. gk5666 is a 2234 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GGTGGGCGGCAAAATATTTTTTCCGCCAAACCGGCAAATTGCCGGAATTGAAAATTTCCG. Right flanking sequence: TTCGGAAGTTAAGTGGCATTTGAAGCCGTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."
Proper citation: RRID:WB-STRAIN:WBStrain00051898 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.