Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

On page 36 showing 701 ~ 720 out of 1,464 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:RGD_629142769

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=629142769

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 629142769
Notes: The is the wild type litter mate for the Dmd mutant: CD-Dmdem1Gene (RGD:629142768), Genethon; 1, bis rue de l’internationale23 91000 Evry, France

Proper citation: RRID:RGD_629142769 Copy   


  • RRID:RGD_629142768

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=629142768

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 629142768
Notes: The model was generated using a single guide RNA-Cas9 targeted to exon 45 of the rat Dmd gene on a Sprague-Dawley (CD®(SD), Crl:CD(SD)) background. One male founder with a 606 bp deletion encompassing Dmd exon 45 and spanning from 207 bp into the 3’ region of intron 44 to 223 bp into the 5’ region of intron 45,including exon 45, was selected for phenotyping. The heterozygous/hemizygous Dmd knock-out lines were used for breeding. Genethon; 1, bis rue de l’internationale23 91000 Evry, France

Proper citation: RRID:RGD_629142768 Copy   


  • RRID:RGD_617301241

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=617301241

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals (as of 2025-07-28)
Alternate IDs: 617301241
Notes: Crl:SD embryos were injected with CRISPR-Cas9 using guide RNA targeting the sequence AGGTCATGGATCTTCCAGCC. A 4-bp deletion in exon 2 (rn7: chr5:126,730,986-126,730,989) resulted. Dr. Noreen Rossi, Contact Email: [email protected]

Proper citation: RRID:RGD_617301241 Copy   


  • RRID:RGD_616390066

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=616390066

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 616390066
Notes: To generate the 5p15.2 deletion in the rat, two CRISPR gRNAs were designed at syntenic loci in the rat genome: ATGTCGATGTCTTGTTAGGGTGG at Chr.2:83120000 (RGSC 6.0/rn6) and GCTGAGATGGCTTTCAGAAATGG at Chr.2:84800000 (RGSC 6.0/rn6), which induced ≈1.68 Mb chromosomal deletion. The Biocytogen Transgenic and Gene Targeting core injected 50 ng uL−1 of each gRNAs and 100 ng uL−1 Cas9 RNA into single‐cell SD rat zygotes. Embryos were cultured overnight and transferred to pseudopregnant females. PCR was used to screen for the deletion. PCR was performed using genomic ear or tail DNA, and the following primer pair: Proximal Forward‐TTGCTCAGCTGTTAAGGGAAACTAT and Distal Reverse‐TCATCAAAATGCACCAAAAGTGCAA (these primers generate ≈485 bp product). PCR primers were used to detect the breakpoint on the undeleted 5p15.2 interval (wild‐type allele): Proximal Forward‐TTGCTCAGCTGTTAAGGGAAACTAT and Proximal Reverse‐GGAGTAAGTCAACTGACTAGGGGACA (these primers generate ≈618 bp product).

Proper citation: RRID:RGD_616390066 Copy   


  • RRID:RGD_617301243

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=617301243

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals (as of 2025-07-28)
Alternate IDs: 617301243
Notes: Crl:SD embryos were injected with CRISPR-Cas9 using guide RNA targeting the sequence GAATACATTCAGAAGCGCTT. A 29-bp deletion in exon 5 (rn7: chr10:46,393,272-46,393,300) resulted. Dr. Noreen Rossi, Contact Email: [email protected]

Proper citation: RRID:RGD_617301243 Copy   


  • RRID:RGD_626170601

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=626170601

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals (as of 2025-09-02)
Alternate IDs: 626170601
Notes: In collaboration with Horizon Discovery, we generated a CRISPR/Cas9-mediated deletion of a 1065bp region spanning Grin2a exon 8 (which encodes key pore forming domains of GluN2A) in Long Evans (LE) embryos, generating a KO allele. Simons Initiative for the Developing Brain (SIDB), Institute for Neuroscience and Cardiovascular Research, University of Edinburgh, Edinburgh EH8 9XD, UK. Contact SIDB Scientific Officer for enquiries on rat distribution ([email protected]).

Proper citation: RRID:RGD_626170601 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=629116668

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2025-12-09)
Alternate IDs: 629116668
Notes: The knock-in rat line was engineered to express the iCRE recombinase under the SLC6A9 locus. It was generated in SD background and maintain in this background for many generations. Rat Resource and Research Center

Proper citation: RRID:RGD_629116668 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=626168268

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Embryo; Cryorecovery (as of 2025-08-29)
Alternate IDs: 626168268
Notes: Deletion of the genetic interval Sult1a1-Spn of Sprague Dawley rat: we targeted an extended sequence of the whole locus from one allele and the CRISPR/Cas9 system allowed us to remove the region encompassing 28 genes, orthologous to human. European Mouse Mutant Archive(EMMA)

Proper citation: RRID:RGD_626168268 Copy   


  • RRID:RGD_629142772

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=629142772

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2025-12-30)
Alternate IDs: 629142772
Notes: Cas9 and sgRNA targeting the sequence GCTTTGCAACTTGTGCAGCA were injected into SS embryos to mutate a CTCF binding site within the first intron of Golt1a. a 3-bp deletion rn6 chr13:50,545,341-50,545,343 resulted. Custom Rats at Medical College of Wisconsin, Email: [email protected]

Proper citation: RRID:RGD_629142772 Copy   


  • RRID:RGD_629142773

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=629142773

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2025-12-30)
Alternate IDs: 629142773
Notes: Cas9 and sgRNA targeting the sequence GGGCATCTTCTGCCACCTAC were injected into SS embryos to mutate a CTCF binding site within the first intron of Ren. An 11-bp deletion rn6 chr13:50,509,649-50,509,659 resulted. Custom Rats at Medical College of Wisconsin, Email: [email protected]

Proper citation: RRID:RGD_629142773 Copy   


  • RRID:RGD_626469804

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=626469804

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Embryo (as of 2025-09-17)
Alternate IDs: 626469804
Notes: This is a Tbx21 knockout rat created using ZFN technology targeting exon 1 coding sequences 378-412. The resulting mutation is a 22-bp deletion (392-413). Inotiv

Proper citation: RRID:RGD_626469804 Copy   


  • RRID:RGD_632517841

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=632517841

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals (as of 2026-01-28)
Alternate IDs: 632517841
Notes: CRISPR/Cas9-mediated knock-in of an IRES-Cre cassette into the 3' UTR of the endogenous Oxtr gene. The line is maintained in the heterozygous state and preserves normal Oxtr expression. Availability Contact Email: [email protected],Central Institute of Mental Health

Proper citation: RRID:RGD_632517841 Copy   


  • RRID:RGD_617148292

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=617148292

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2025-07-07)
Alternate IDs: 617148292
Notes: Four single guide RNAs and SpCas9 targeting sequences ATGAAGTGCCTAGCTTCATT, GAAGCTAGGCACTTCATCTA, ATTCATAATGGGACACTCGA, and CCCAGCCTCAGATTCATAAT flanking a chromosome 2 region distal to Npr3 were targeted in SS/JrHsdMcwi embryos. A 29,508 bp deletion in chromosome 2 (rn6: chr2:61,845,176-61,874,684) resulted, along with an insertion of 3 nucleotides (TGG). Please contact: [email protected]

Proper citation: RRID:RGD_617148292 Copy   


  • RRID:RGD_626419677

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=626419677

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Embryo (as of 2025-09-05)
Alternate IDs: 626419677
Notes: Gnal knockout rats were generated by CRISPR/Cas9 technology. Exon1 of rat Gnal splicing variant 2 was targeted, resulting in a deletion of 1 base pair that corresponds to position 44 downstream of the translation start point ATG of the Gnal splicing variant 2. CRISPR technology details: self-synthesized Cas9 mRNA using px 330 vector, applying T7 transcription kit followed by Poly-Adenylation and Capping. No sequencing performed, whether Cas9 has been inserted into the rat genome is unknown. Homozygous: Approximately 25% body weight reduction; Smaller body size; Hyperactivity; Better rotarod performance than wild-type littermates.Heterozygous: No body weight change; No body size change; Hypo-activity; Worse rotarod performance than wild-type littermates. European Mouse Mutant Archive(EMMA)

Proper citation: RRID:RGD_626419677 Copy   


  • RRID:RGD_626170599

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=626170599

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals (as of 2025-09-02)
Alternate IDs: 626170599
Notes: This KO allele was generated by Sigma Advanced Genetic Engineering (SAGE) Labs (St. Louis, MO, US) by injecting CRISPR/Cas9 reagents and sgRNA targeting exon 8 (gtgcatagagcatgtcgtccAGG) into Long Evans (LE) zygotes. Founder #23 displayed a 2bp deletion and 1bp insertion, leading to a frameshift mutation in exon 8 of Syngap1, which prevents expression of the protein. Homozygous Syngap1 KO rats die perinatally, but heterozygous Syngap1 KO rats appear healthy and are fertile. Simons Initiative for the Developing Brain (SIDB), Institute for Neuroscience and Cardiovascular Research, University of Edinburgh, Edinburgh EH8 9XD, UK. Contact SIDB Scientific Officer for enquiries on rat distribution ([email protected]).

Proper citation: RRID:RGD_626170599 Copy   


  • RRID:RGD_629020173

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=629020173

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 629020173
Notes: The Cre recombinase gene was knocked into exon 2 of the Drd2 gene using CRISPR/Cas9 genome editing. RRRC:00979

Proper citation: RRID:RGD_629020173 Copy   


  • RRID:RGD_626168248

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=626168248

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals (as of 2025-08-28)
Alternate IDs: 626168248
Notes: The CRISPR/Cas9 system was used to delete the FIRE ( Fms intronic regulatory element) enhancer of the Csf1r gene of LE rat embryos Clare Pridans Centre for Inflammation Research Institute for Regeneration and Repair The University of Edinburgh

Proper citation: RRID:RGD_626168248 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=405100723

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 405100723
Notes: The CRISPR/Case9 knock-in of CAG-LSL-Ghsr (LSL: loxp-Stop-Loxp) to the ROSA 26 locus of LE rats has cre recombinase-dependent expression of rat Ghsr under the control of CAG promoter. ROSA26 is a synonym for rat Thumpd3-as1 (RGD:6491660) and is used as an official symbol for rat strain nomenclature.

Proper citation: RRID:RGD_405100723 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=625777900

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Embryo (as of 2025-08-06)
Alternate IDs: 625777900
Notes: Ugt2 (cluster) KO strain: The Ugt2 cluster was disrupted using the genome editing technology CRISPR/Cas9, and F1 rats (heterozygotes) were produced by crossing with Wistar (Crlj:WI) rats. The F1 rats were then crossed with each other to produce a homozygous strain. Ugt2 KO map Tc (UGT2-MAC) strain (Tc: transchromosomic): After introducing UGT2-MAC into rat ES cells (BLK2i-1), chimera rats were produced, which were then crossed with Wistar rats to produce F1 transmission rats, and further crossed with Wistar rats for several generations to produce strain rats. The MAC vector consists of the following genes: HPRT gene full length sequence, bovine growth hormone (BGH) polyA signal, b-actin promoter, b-globin insulator, CMV-IE enhancer, SV40 polyA signal, loxP sequence, FRT sequence, ampicillin resistance gene, neomycin resistance gene, kanamycin resistance gene, puromycin resistance gene, green fluorescent protein (GFP) gene and its mutants, PGK promoter, mouse chromosome 11 centromere region Tc (UGT2-MAC)-UGT2 strain: The strain was created by crossing the Tc(UGT2-MAC) strain with the Ugt2 (cluster) KO strain. National BioResource Project for the Rat in Japan

Proper citation: RRID:RGD_625777900 Copy   


  • RRID:RGD_19165364

    This resource has 1+ mentions.

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=19165364

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals (as of 2026-03-05)
Alternate IDs: 19165364
Notes: Cas9 protein and sgRNA targeting the sequence CCTTTTTGCAGAGCACGAAA within exon 2 of Adcy3 were injected into embryos of the WKY/NCrl strain. A 3-bp deletion resulted (rn7: chr6:27,126,062-27,126,064). Contact Dr. Solberg-Woods at Wake Forest University School of Medicine, Email: [email protected]

Proper citation: RRID:RGD_19165364 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X