Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
WI-Ugt2em1YakazTc(HSA4-UGT2)Yakaz/Yakaz Resource Report Resource Website |
RRID:RGD_625777900 | Rattus norvegicus | Ugt2 (cluster) KO strain: The Ugt2 cluster was disrupted using the genome editing technology CRISPR/Cas9, and F1 rats (heterozygotes) were produced by crossing with Wistar (Crlj:WI) rats. The F1 rats were then crossed with each other to produce a homozygous strain. Ugt2 KO map Tc (UGT2-MAC) strain (Tc: transchromosomic): After introducing UGT2-MAC into rat ES cells (BLK2i-1), chimera rats were produced, which were then crossed with Wistar rats to produce F1 transmission rats, and further crossed with Wistar rats for several generations to produce strain rats. The MAC vector consists of the following genes: HPRT gene full length sequence, bovine growth hormone (BGH) polyA signal, b-actin promoter, b-globin insulator, CMV-IE enhancer, SV40 polyA signal, loxP sequence, FRT sequence, ampicillin resistance gene, neomycin resistance gene, kanamycin resistance gene, puromycin resistance gene, green fluorescent protein (GFP) gene and its mutants, PGK promoter, mouse chromosome 11 centromere region Tc (UGT2-MAC)-UGT2 strain: The strain was created by crossing the Tc(UGT2-MAC) strain with the Ugt2 (cluster) KO strain. National BioResource Project for the Rat in Japan | 625777900 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Embryo (as of 2025-08-06) | 625777900 | 2026-09-05 06:52:47 | 0 | |||||
|
WKY-Adcy3em2Mcwi-/- Resource Report Resource Website 1+ mentions |
RRID:RGD_19165364 | Rattus norvegicus | Cas9 protein and sgRNA targeting the sequence CCTTTTTGCAGAGCACGAAA within exon 2 of Adcy3 were injected into embryos of the WKY/NCrl strain. A 3-bp deletion resulted (rn7: chr6:27,126,062-27,126,064). Contact Dr. Solberg-Woods at Wake Forest University School of Medicine, Email: [email protected] | 19165364 | mutant | Rat Genome Database (RGD) | RGD | Live Animals (as of 2026-03-05) | 19165364 | 2026-09-05 06:52:47 | 1 | |||||
|
SHR/Kyo Resource Report Resource Website |
RRID:RGD_1302620 | Rattus norvegicus | Okamoto 1963 from outbred Wistar Kyoto rats. Bred from a male with mild hypertension, mated with a female with high blood pressure. Brother x sister mating with continued selection for high blood pressure (Okamoto 1969, Okamoto et al 1972). National BioResource Project for the Rat in Japan | 1302620 | mutant | Rat Genome Database (RGD) | RGD | Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2021-11-12) | 1302620 | 2026-09-05 06:52:11 | 0 | |||||
|
W-Plp1md/Nya Resource Report Resource Website 1+ mentions |
RRID:RGD_1358918 | Rattus norvegicus | Wistar rats were received in 1957 from Walter Reed Army Medical Center. In 1977, three ofsprings exhibited body tremor. Two of these had hydrocephalus and the brain of the third was normal. The mother rat and four of its clinically mormal youngs along with three adult males were breed as nuclear breeders. | 1358918 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 1358918 | 2026-09-05 06:52:13 | 1 | |||||
|
Gunn-Ugt1a1j/BluHsd Resource Report Resource Website |
RRID:RGD_1357186 | Rattus norvegicus | This mutation was first observed in normal Wistar albino rats in a breeding colony at Cannaught Laboratories in 1934. Jaundice was evident at birth or shortly after and was persistant throughout life. Harlan | 1357186 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 1357186 | 2026-09-05 06:52:13 | 0 | |||||
|
BN-Adora2am2Mcwi Resource Report Resource Website |
RRID:RGD_1599757 | Rattus norvegicus | Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. Q310L mutation is generated from the codon change CAG/CTG of rat Adora2a. | 1599757 | mutant | Rat Genome Database (RGD) | RGD | Extinct (as of 2016-10-24) | 1599757 | 2026-09-05 06:52:15 | 0 | |||||
|
BN-Has2m1Mcwi Resource Report Resource Website |
RRID:RGD_1599756 | Rattus norvegicus | Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. Y344Stop mutation is generated from the codon change TAT/TAA. | 1599756 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 1599756 | 2026-09-05 06:52:15 | 0 | |||||
|
BN-Tgfbr2m1Mcwi Resource Report Resource Website |
RRID:RGD_1579688 | Rattus norvegicus | Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. T289M mutation is generated from the codon change ACG/ATG. | 1579688 | mutant | Rat Genome Database (RGD) | RGD | Extinct (as of 2017-01-26) | 1579688 | 2026-09-05 06:52:16 | 0 | |||||
|
HOB-Unc5chob/Snk Resource Report Resource Website |
RRID:RGD_1554302 | Rattus norvegicus | Homozygous hobble rats that were taken from the inbred hobble rat colony. National BioResource Project for the Rat in Japan | 1554302 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 1554302 | 2026-09-05 06:52:15 | 0 | |||||
|
FHH-Klf6m1Mcwi Resource Report Resource Website |
RRID:RGD_1579712 | Rattus norvegicus | Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. V135G mutation is generated. | 1579712 | mutant | Rat Genome Database (RGD) | RGD | Extinct (as of 2017-01-26) | 1579712 | 2026-09-05 06:52:16 | 0 | |||||
|
BN-Birc3m1Mcwi Resource Report Resource Website |
RRID:RGD_1579681 | Rattus norvegicus | Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.W76G mutation is generated. | 1579681 | mutant | Rat Genome Database (RGD) | RGD | Extinct (as of 2016-10-24) | 1579681 | 2026-09-05 06:52:16 | 0 | |||||
|
SS-Htr1am2Mcwi Resource Report Resource Website |
RRID:RGD_1599767 | Rattus norvegicus | Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. G76R mutation is generated from the codon change GGC/CGC. | 1599767 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 1599767 | 2026-09-05 06:52:16 | 0 | |||||
|
FHH-Bdkrb2m1Mcwi Resource Report Resource Website |
RRID:RGD_1579895 | Rattus norvegicus | Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. I214T mutation is generated. | 1579895 | mutant | Rat Genome Database (RGD) | RGD | Extinct (as of 2016-10-24) | 1579895 | 2026-09-05 06:52:17 | 0 | |||||
|
SS-Bdkrb2m2Mcwi Resource Report Resource Website |
RRID:RGD_1599762 | Rattus norvegicus | Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. E178V mutation is generated from the codon change GAA/GTA. | 1599762 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 1599762 | 2026-09-05 06:52:17 | 0 | |||||
|
BN-Lcatm2Mcwi Resource Report Resource Website |
RRID:RGD_1599761 | Rattus norvegicus | Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. D359E mutation is generated from the codon change GAC/GAG. | 1599761 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 1599761 | 2026-09-05 06:52:17 | 0 | |||||
|
FHH-Fgl2m1Mcwi Resource Report Resource Website |
RRID:RGD_1579909 | Rattus norvegicus | Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. A301S mutation is generated from the codon change GCA/TCA. | 1579909 | mutant | Rat Genome Database (RGD) | RGD | Extinct (as of 2017-01-26) | 1579909 | 2026-09-05 06:52:17 | 0 | |||||
|
FHH-Ccr4m1Mcwi Resource Report Resource Website |
RRID:RGD_1581642 | Rattus norvegicus | Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. I133V mutation is generated from the codon change ATA/GTA. | 1581642 | mutant | Rat Genome Database (RGD) | RGD | Extinct (as of 2017-01-26) | 1581642 | 2026-09-05 06:52:16 | 0 | |||||
|
BN-Hand1m1Mcwi Resource Report Resource Website |
RRID:RGD_1581625 | Rattus norvegicus | Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. S109G mutation is generated from the codon change AGC/GGC. | 1581625 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 1581625 | 2026-09-05 06:52:17 | 0 | |||||
|
FHH-Nr4a1m1Mcwi Resource Report Resource Website |
RRID:RGD_1579706 | Rattus norvegicus | Male founders (FHH/EurMcwi) were injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups were genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. Y130Stop mutation was generated from the codon change TAC/TAA. | 1579706 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2017-01-26) | 1579706 | 2026-09-05 06:52:17 | 0 | |||||
|
SS-Lcatm4Mcwi Resource Report Resource Website |
RRID:RGD_1642366 | Rattus norvegicus | Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. Y336N mutation is generated from the codon change TAT/AAT. | 1642366 | mutant | Rat Genome Database (RGD) | RGD | Extinct (as of 2017-01-26) | 1642366 | 2026-09-05 06:52:18 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
