Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Background:mutant (facet)

Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

1,464 Results - per page

Show More Columns | Download Top 1000 Results

Organism Name Proper Citation Species Synonyms Notes Phenotype Affected Gene Genomic Alteration Catalog Number Background Database Database Abbreviation Availability Source References Alternate IDs Record Last Update Mentions Count
SD-Shank3em1Bcgen
 
Resource Report
Resource Website
RRID:RGD_631721277 Rattus norvegicus The mutant rats were generated using CRISPR/Cas9 technology to target upstream of exon 11 or downstream of exon 21 of rat Shank3. The resulting mutant carried approximately 26 kb deletions with the removal of the Shank3 exon 11–21 [email protected] at Department of Neurobiology, School of Basic Medical Sciences, Peking University, Beijing, China 631721277 mutant Rat Genome Database (RGD) RGD Unknown 631721277 2026-09-05 06:52:47 0
SD-Ager em1Mcwi
 
Resource Report
Resource Website
RRID:RGD_152998995 Rattus norvegicus This model was generated at the Medical College of Wisconsin by CRISPR/Cas9 in Crl:SD strain. The resulting mutation is a 16-bp deletion in the third exon of Ager. rn6.0:chr20:4,150,397-4,150,412. contact MCW Rat Distribution at [email protected] 152998995 mutant Rat Genome Database (RGD) RGD Cryopreserved Sperm (as of 2022-07-15) 152998995 2026-09-05 06:52:47 0
CD-Dmdem1Gene+/+
 
Resource Report
Resource Website
RRID:RGD_629142769 Rattus norvegicus The is the wild type litter mate for the Dmd mutant: CD-Dmdem1Gene (RGD:629142768), Genethon; 1, bis rue de l’internationale23 91000 Evry, France 629142769 mutant Rat Genome Database (RGD) RGD Unknown 629142769 2026-09-05 06:52:47 0
CD-Dmdem1Gene
 
Resource Report
Resource Website
RRID:RGD_629142768 Rattus norvegicus The model was generated using a single guide RNA-Cas9 targeted to exon 45 of the rat Dmd gene on a Sprague-Dawley (CD®(SD), Crl:CD(SD)) background. One male founder with a 606 bp deletion encompassing Dmd exon 45 and spanning from 207 bp into the 3’ region of intron 44 to 223 bp into the 5’ region of intron 45,including exon 45, was selected for phenotyping. The heterozygous/hemizygous Dmd knock-out lines were used for breeding. Genethon; 1, bis rue de l’internationale23 91000 Evry, France 629142768 mutant Rat Genome Database (RGD) RGD Unknown 629142768 2026-09-05 06:52:47 0
SD-Slc5a9em1Mcwi
 
Resource Report
Resource Website
RRID:RGD_617301241 Rattus norvegicus Crl:SD embryos were injected with CRISPR-Cas9 using guide RNA targeting the sequence AGGTCATGGATCTTCCAGCC. A 4-bp deletion in exon 2 (rn7: chr5:126,730,986-126,730,989) resulted. Dr. Noreen Rossi, Contact Email: [email protected] 617301241 mutant Rat Genome Database (RGD) RGD Live Animals (as of 2025-07-28) 617301241 2026-09-05 06:52:47 0
SD-CdCSem1Bcgen+/-
 
Resource Report
Resource Website
RRID:RGD_616390066 Rattus norvegicus To generate the 5p15.2 deletion in the rat, two CRISPR gRNAs were designed at syntenic loci in the rat genome: ATGTCGATGTCTTGTTAGGGTGG at Chr.2:83120000 (RGSC 6.0/rn6) and GCTGAGATGGCTTTCAGAAATGG at Chr.2:84800000 (RGSC 6.0/rn6), which induced ≈1.68 Mb chromosomal deletion. The Biocytogen Transgenic and Gene Targeting core injected 50 ng uL−1 of each gRNAs and 100 ng uL−1 Cas9 RNA into single‐cell SD rat zygotes. Embryos were cultured overnight and transferred to pseudopregnant females. PCR was used to screen for the deletion. PCR was performed using genomic ear or tail DNA, and the following primer pair: Proximal Forward‐TTGCTCAGCTGTTAAGGGAAACTAT and Distal Reverse‐TCATCAAAATGCACCAAAAGTGCAA (these primers generate ≈485 bp product). PCR primers were used to detect the breakpoint on the undeleted 5p15.2 interval (wild‐type allele): Proximal Forward‐TTGCTCAGCTGTTAAGGGAAACTAT and Proximal Reverse‐GGAGTAAGTCAACTGACTAGGGGACA (these primers generate ≈618 bp product). 616390066 mutant Rat Genome Database (RGD) RGD Unknown 616390066 2026-09-05 06:52:47 0
SD-Slc5a10em1Mcwi
 
Resource Report
Resource Website
RRID:RGD_617301243 Rattus norvegicus Crl:SD embryos were injected with CRISPR-Cas9 using guide RNA targeting the sequence GAATACATTCAGAAGCGCTT. A 29-bp deletion in exon 5 (rn7: chr10:46,393,272-46,393,300) resulted. Dr. Noreen Rossi, Contact Email: [email protected] 617301243 mutant Rat Genome Database (RGD) RGD Live Animals (as of 2025-07-28) 617301243 2026-09-05 06:52:47 0
LE-Grin2aem1Sidb
 
Resource Report
Resource Website
RRID:RGD_626170601 Rattus norvegicus In collaboration with Horizon Discovery, we generated a CRISPR/Cas9-mediated deletion of a 1065bp region spanning Grin2a exon 8 (which encodes key pore forming domains of GluN2A) in Long Evans (LE) embryos, generating a KO allele. Simons Initiative for the Developing Brain (SIDB), Institute for Neuroscience and Cardiovascular Research, University of Edinburgh, Edinburgh EH8 9XD, UK. Contact SIDB Scientific Officer for enquiries on rat distribution ([email protected]). 626170601 mutant Rat Genome Database (RGD) RGD Live Animals (as of 2025-09-02) 626170601 2026-09-05 06:52:47 0
SD-Slc6a9em1(cre)Mira
 
Resource Report
Resource Website
RRID:RGD_629116668 Rattus norvegicus The knock-in rat line was engineered to express the iCRE recombinase under the SLC6A9 locus. It was generated in SD background and maintain in this background for many generations. Rat Resource and Research Center 629116668 mutant Rat Genome Database (RGD) RGD Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2025-12-09) 629116668 2026-09-05 06:52:47 0
SD-Del(Sult1a1-Spn)/YahIcsOrl
 
Resource Report
Resource Website
RRID:RGD_626168268 Rattus norvegicus Deletion of the genetic interval Sult1a1-Spn of Sprague Dawley rat: we targeted an extended sequence of the whole locus from one allele and the CRISPR/Cas9 system allowed us to remove the region encompassing 28 genes, orthologous to human. European Mouse Mutant Archive(EMMA) 626168268 mutant Rat Genome Database (RGD) RGD Cryopreserved Embryo; Cryorecovery (as of 2025-08-29) 626168268 2026-09-05 06:52:47 0
SS-Rrg2em1Mcwi
 
Resource Report
Resource Website
RRID:RGD_629142772 Rattus norvegicus Cas9 and sgRNA targeting the sequence GCTTTGCAACTTGTGCAGCA were injected into SS embryos to mutate a CTCF binding site within the first intron of Golt1a. a 3-bp deletion rn6 chr13:50,545,341-50,545,343 resulted. Custom Rats at Medical College of Wisconsin, Email: [email protected] 629142772 mutant Rat Genome Database (RGD) RGD Cryopreserved Sperm (as of 2025-12-30) 629142772 2026-09-05 06:52:47 0
SS-Rrg3em1Mcwi
 
Resource Report
Resource Website
RRID:RGD_629142773 Rattus norvegicus Cas9 and sgRNA targeting the sequence GGGCATCTTCTGCCACCTAC were injected into SS embryos to mutate a CTCF binding site within the first intron of Ren. An 11-bp deletion rn6 chr13:50,509,649-50,509,659 resulted. Custom Rats at Medical College of Wisconsin, Email: [email protected] 629142773 mutant Rat Genome Database (RGD) RGD Cryopreserved Sperm (as of 2025-12-30) 629142773 2026-09-05 06:52:47 0
SD-Tbx21em1Sage
 
Resource Report
Resource Website
RRID:RGD_626469804 Rattus norvegicus This is a Tbx21 knockout rat created using ZFN technology targeting exon 1 coding sequences 378-412. The resulting mutation is a 22-bp deletion (392-413). Inotiv 626469804 mutant Rat Genome Database (RGD) RGD Cryopreserved Embryo (as of 2025-09-17) 626469804 2026-09-05 06:52:47 0
SD-Oxtrem1(cre)Grin
 
Resource Report
Resource Website
RRID:RGD_632517841 Rattus norvegicus CRISPR/Cas9-mediated knock-in of an IRES-Cre cassette into the 3' UTR of the endogenous Oxtr gene. The line is maintained in the heterozygous state and preserves normal Oxtr expression. Availability Contact Email: [email protected],Central Institute of Mental Health 632517841 mutant Rat Genome Database (RGD) RGD Live Animals (as of 2026-01-28) 632517841 2026-09-05 06:52:47 0
SS-Del(2q)1Mcwi +/+
 
Resource Report
Resource Website
RRID:RGD_617148292 Rattus norvegicus Four single guide RNAs and SpCas9 targeting sequences ATGAAGTGCCTAGCTTCATT, GAAGCTAGGCACTTCATCTA, ATTCATAATGGGACACTCGA, and CCCAGCCTCAGATTCATAAT flanking a chromosome 2 region distal to Npr3 were targeted in SS/JrHsdMcwi embryos. A 29,508 bp deletion in chromosome 2 (rn6: chr2:61,845,176-61,874,684) resulted, along with an insertion of 3 nucleotides (TGG). Please contact: [email protected] 617148292 mutant Rat Genome Database (RGD) RGD Cryopreserved Sperm (as of 2025-07-07) 617148292 2026-09-05 06:52:47 0
SD-Gnalem2Hpng
 
Resource Report
Resource Website
RRID:RGD_626419677 Rattus norvegicus Gnal knockout rats were generated by CRISPR/Cas9 technology. Exon1 of rat Gnal splicing variant 2 was targeted, resulting in a deletion of 1 base pair that corresponds to position 44 downstream of the translation start point ATG of the Gnal splicing variant 2. CRISPR technology details: self-synthesized Cas9 mRNA using px 330 vector, applying T7 transcription kit followed by Poly-Adenylation and Capping. No sequencing performed, whether Cas9 has been inserted into the rat genome is unknown. Homozygous: Approximately 25% body weight reduction; Smaller body size; Hyperactivity; Better rotarod performance than wild-type littermates.Heterozygous: No body weight change; No body size change; Hypo-activity; Worse rotarod performance than wild-type littermates. European Mouse Mutant Archive(EMMA) 626419677 mutant Rat Genome Database (RGD) RGD Cryopreserved Embryo (as of 2025-09-05) 626419677 2026-09-05 06:52:47 0
LE-Syngap1em1Sidb
 
Resource Report
Resource Website
RRID:RGD_626170599 Rattus norvegicus This KO allele was generated by Sigma Advanced Genetic Engineering (SAGE) Labs (St. Louis, MO, US) by injecting CRISPR/Cas9 reagents and sgRNA targeting exon 8 (gtgcatagagcatgtcgtccAGG) into Long Evans (LE) zygotes. Founder #23 displayed a 2bp deletion and 1bp insertion, leading to a frameshift mutation in exon 8 of Syngap1, which prevents expression of the protein. Homozygous Syngap1 KO rats die perinatally, but heterozygous Syngap1 KO rats appear healthy and are fertile. Simons Initiative for the Developing Brain (SIDB), Institute for Neuroscience and Cardiovascular Research, University of Edinburgh, Edinburgh EH8 9XD, UK. Contact SIDB Scientific Officer for enquiries on rat distribution ([email protected]). 626170599 mutant Rat Genome Database (RGD) RGD Live Animals (as of 2025-09-02) 626170599 2026-09-05 06:52:47 0
LE-Drd2em1(Cre)Rrrc
 
Resource Report
Resource Website
RRID:RGD_629020173 Rattus norvegicus The Cre recombinase gene was knocked into exon 2 of the Drd2 gene using CRISPR/Cas9 genome editing. RRRC:00979 629020173 mutant Rat Genome Database (RGD) RGD Unknown 629020173 2026-09-05 06:52:47 0
LE-Csf1rem1Prdns
 
Resource Report
Resource Website
RRID:RGD_626168248 Rattus norvegicus The CRISPR/Cas9 system was used to delete the FIRE ( Fms intronic regulatory element) enhancer of the Csf1r gene of LE rat embryos Clare Pridans Centre for Inflammation Research Institute for Regeneration and Repair The University of Edinburgh 626168248 mutant Rat Genome Database (RGD) RGD Live Animals (as of 2025-08-28) 626168248 2026-09-05 06:52:47 0
LE-ROSA26 em1(CAG-Ghsr)Ottc
 
Resource Report
Resource Website
RRID:RGD_405100723 Rattus norvegicus The CRISPR/Case9 knock-in of CAG-LSL-Ghsr (LSL: loxp-Stop-Loxp) to the ROSA 26 locus of LE rats has cre recombinase-dependent expression of rat Ghsr under the control of CAG promoter. ROSA26 is a synonym for rat Thumpd3-as1 (RGD:6491660) and is used as an official symbol for rat strain nomenclature. 405100723 mutant Rat Genome Database (RGD) RGD Unknown 405100723 2026-09-05 06:52:47 0

Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.