Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Background:mutant (facet)

Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

1,464 Results - per page

Show More Columns | Download Top 1000 Results

Organism Name Proper Citation Species Synonyms Notes Phenotype Affected Gene Genomic Alteration Catalog Number Background Database Database Abbreviation Availability Source References Alternate IDs Record Last Update Mentions Count
SD-C5ar1em22Taoki
 
Resource Report
Resource Website
RRID:RGD_598092525 Rattus norvegicus This strain was established by CRISPR/Cas9 system in the Research Institute, National Cerebral and Cardiovascular Center. Genetic background is Slc:SD. guide RNA gRNA No1; ATAAGTAACGACAGCAGTGA gRNA No2; GAGTTTCACTCGGTCCACGA National BioResource Project for the Rat in Japan 598092525 mutant Rat Genome Database (RGD) RGD Cryopreserved Sperm (as of 2025-03-25) 598092525 2026-09-05 06:52:47 0
Slc:WSRC-KitWs
 
Resource Report
Resource Website
RRID:RGD_598092524 Rattus norvegicus In 1987, a Ws mutant (RGD:12910762) with a light-colored coat and large abdominal white spots was discovered in a colony of BN/fMai inbred rats that had been allocated to Yagi Memorial Park from the Institute of Laboratory Animals Graduate School of Medicine, Kyoto University. However, homozygous for the Ws mutation could not be obtained in BN inbred rats due to embryonic lethality. Therefore, they crossed with Donryu outbred rats and obtained homozygous by crossing F1 heterozygous. This strain was designated as WsRC and was supplied to Japan SLC, Inc. in 1993. National BioResource Project for the Rat in Japan 598092524 mutant Rat Genome Database (RGD) RGD Cryopreserved Embryo (as of 2025-03-25) 598092524 2026-09-05 06:52:46 0
SD-Cyp2dem2(CYP2D6)Kg
 
Resource Report
Resource Website
RRID:RGD_407446371 Rattus norvegicus A ~58.0 kb deletion of the rat Cyp2d gene cluster (1-5) was created using the CRISPR-Cas9 system. Subsequently, the human CYP2D6 gene (~6.2 kb) was inserted in place of the rat Cyp2d gene cluster. The rat strain is deposited to Rat Research and Resource Contact [email protected] for availability. 407446371 mutant Rat Genome Database (RGD) RGD Cryopreserved Embryo; Cryopreserved Sperm (as of 2024-08-29) 407446371 2026-09-05 06:52:46 0
SD-Cyp2dem1Kg
 
Resource Report
Resource Website
RRID:RGD_407446370 Rattus norvegicus A ~58.0 kb deletion of the rat Cyp2d gene cluster (1-5) was created using the CRISPR-Cas9 system. The rat strain is deposited to Rat Research and Resource Contact [email protected] for availability. 407446370 mutant Rat Genome Database (RGD) RGD Unknown (as of 2024-08-29) 407446370 2026-09-05 06:52:46 0
SHR-Tti2em1Ipcv+/-
 
Resource Report
Resource Website
RRID:RGD_405849381 Rattus norvegicus This Tti2 knockout rats were generated by microinjecting fertilized ova of SHR/OlaIpcv rats with the ZFN (Zinc Finger Nuclease) construct from Sigma-Aldrich. The construct was designed to target the first exon using the following sequence of ZFN binding (capital letters) and cutting site (small letters): TCTGACCCGGATCCAAGCaccaagGGTGGGTGGCAGGGC. DNA samples isolated from 452 rats born after microinjection with ZFN construct were amplified using primers flanking the target sequence: ZFN F: 5'-TACACTGTGATTGGCTGGGA-3' and ZFN R: 5'-GGCGCAGTGGAGTGATC-3'. SHR-Tti2+/- with an 8 bp deletion (NM_001013883.1(Tti2):c.243_250delCGAGATCC; on the protein level: NP_001013905.1:p.Glu82Glyfs) has been selected for further analyses. The heterozygous founder was crossed with SHR and F1 rats were intercrossed. SHR-Tti2+/- heterozygotes were selected for breeding and phenotyping while their wild type littermates were used as controls. 405849381 mutant Rat Genome Database (RGD) RGD Unknown 405849381 2026-09-05 06:52:46 0
SD-Vdrem2Hfd
 
Resource Report
Resource Website
RRID:RGD_408364956 Rattus norvegicus The CRISPR/Cas9 system was used to introduce deletion and insertion in exon 3 of the VDR gene of Hsd:SD rat embryos WT: GGAGGCAACAGCGGCCAGCACCTCCCTGCccgaccCTGGTGACTTTGACCggaacgtgccccGGATCTGTGGAGTGTGTGGAGACCGAGCCAC KO: GGAGGCAACAGCGGCCAGCACCTCCCTGCtggt– CTGGTGACTTTGACC------GGATCTGTGGAGTGTGTGGAGACCGAGCCAC Rat Resource and Research Center (RRRC); strain ID 1034 408364956 mutant Rat Genome Database (RGD) RGD Cryopreserved Embryo (as of 2024-11-05) 408364956 2026-09-05 06:52:46 0
F344-ApcPirc/UwmVdrem3Hfd
 
Resource Report
Resource Website
RRID:RGD_408364957 Rattus norvegicus The F344-ApcPirc rat was generated previously by ENU mutagenesis (RGD ID 1641862). These fertilized rat embryos were used with the CRISPR/Cas9 system to introduce a 5-bp deletion (CCCCG) in exon 3 of the Vdr gene. This mutant was heterozygous for the Apc mutation and homozygous for the VDR deletion. WT: GGAGGCAACAGCGGCCAGCACCTCCCTGCCCGACCCTGGTGACTTTGACCGGAACGTGCCCCGGATCTGTGGAGTGTGTGGAGACCGAGCCAC KO: GGAGGCAACAGCGGCCAGCACCTCCCTGCCCGACCCTGGTGACTTTGACCGGAACGTGG ATCTGTGGAGTGTGTGGAGACCGAGCCAC Rat Resource and Research Center (RRRC); strain ID 1033 408364957 mutant Rat Genome Database (RGD) RGD Cryopreserved Sperm (as of 2024-11-05) 408364957 2026-09-05 06:52:46 0
SD-Eml1tish/Scrb
 
Resource Report
Resource Website
RRID:RGD_597538479 Rattus norvegicus The first tish animals were identified on the basis of postmortem histological analyses during the course of unrelated experiments using a strain of Sprague Dawley rats maintained at the University of Virginia. It is called tish (telencephalic internal structural heterotopia) rat. The brain of this mutant animal exhibits a large region of heterotopic gray matter that is located bilaterally beneath the neocortex. Mild to moderate ventriculomegaly is also observed in most tish animals. A breeding colony was established by identifying living relatives of deceased tish individuals, and then these relatives were screened using magnetic resonance imaging (MRI). The tish is identified recessive to wild type by breeding. The mutation was identified as a 1215 bp deletion in the unannotated exon 1 of Eml1 genome (Rnor_6.0; ENSRNOG00000043143). University of Virginia, Charlottesville, VA, United States 597538479 mutant Rat Genome Database (RGD) RGD Unknown 597538479 2026-09-05 06:52:46 0
SD-Il6em1Yona-/-
 
Resource Report
Resource Website
RRID:RGD_407450413 Rattus norvegicus The Il6 knockout (KO) rats were generated using the CRISPR/Cas9 technique to induce a shift in the reading frame of the second exon of Il6 by KAC Co. Ltd (Kyoto, Japan). This strain carried a 118 bp deleted in the second exon of IL-6 National Cerebral and Cardiovascular Center Research Institute, Suita, Osaka 564-8565, Japan 407450413 mutant Rat Genome Database (RGD) RGD Unknown 407450413 2026-09-05 06:52:46 0
WIC;W-Oprk1em1(cre)Nurep
 
Resource Report
Resource Website
RRID:RGD_598154602 Rattus norvegicus Oprk1-cre rats were generated by Dr. Hiroko Tsukamura, Dr. Yoshihisa Uenoyama, Dr. Naoko Inoue, Dr. Mayuko Nagae (Nagoya University) and Dr. Masumi Hirabayashi (National Institute for Physiological Sciences). The CRISPR/Cas9 and adeno-associated virus vector (Oprk1 [exon 4], T2A, Cre) were introduced into the pronuclear stage embryos of Wistar rats (Crlj:WI). It was maintained by mating with the Wistar-Imamichi rats (Iar:WIC) (RGD:125097496) or by sibling mating. National BioResource Project for the Rat in Japan 598154602 mutant Rat Genome Database (RGD) RGD Cryopreserved Sperm (as of 2025-04-30) 598154602 2026-09-05 06:52:47 0
ZFDM-Lcn2em1Nyo
 
Resource Report
Resource Website
RRID:RGD_598154604 Rattus norvegicus "This knock-in rat was generated by injecting guide RNA, Cas9 protein, and ssODN targeting the Lcn2 gene into fertilized eggs of ZFDM rats. The Lcn2 gene of ZFDM rats has a nonsense mutation (c.409C>T, p.Gln137X), but in this line, this mutation is replaced with the wild type sequence by homologous recombination with the introduced ssODN. The target sequence of the guide RNA is TGACTACGACTAGTTTGCCA. The ssODN sequence for inducing homologous recombination is AAGTGGCCGACACTGACTACGACCAGTTTGCCATGGTATTTTTCCAGAAGACCTCTGAAA. " National BioResource Project for the Rat in Japan 598154604 mutant Rat Genome Database (RGD) RGD Cryopreserved Sperm (as of 2025-04-30) 598154604 2026-09-05 06:52:47 0
SD-Crhtm1(Cre)Kji
 
Resource Report
Resource Website
1+ mentions
RRID:RGD_401976372 Rattus norvegicus CRISPR/Cas9 technology was used to insert an IRES for Cre expression after the corticotropin-releasing hormone (Crh) gene and is expressed in cells that produce CRH. 401976372 mutant Rat Genome Database (RGD) RGD Unknown 401976372 2026-09-05 06:52:46 1
SD-Prnpem1Evm
 
Resource Report
Resource Website
RRID:RGD_630350554 Rattus norvegicus A deletion mutation was induced using CRISPR/Cas9 system in embryos of Spague-Dawley rats from Charles River. This strain has been deposited with the RRRC 630350554 mutant Rat Genome Database (RGD) RGD Live Animals (as of 2026-01-15) 630350554 2026-09-05 06:52:47 0
SD-Per1em1Smoc
 
Resource Report
Resource Website
RRID:RGD_629006641 Rattus norvegicus CRISPR/Cas9 system was used to generate rats with a deletion of the CRE site (Del_TGACGTCA) in the Per1 gene promoter Per1 gene in Sprague Dawley (Charles River) rat embryos. National Institute on Drug Dependence and Beijing Key Laboratory on Drug Dependence Research, Peking University, Beijing, China 629006641 mutant Rat Genome Database (RGD) RGD Unknown 629006641 2026-09-05 06:52:47 0
LH-C17h6orf52em2Aek
 
Resource Report
Resource Website
RRID:RGD_630350551 Rattus norvegicus The CRISPR/Cas9 system was used to delete the entire C17h6orf52 gene from LH/MavRrrcAek embryos. Deletion ranges on chromosome 17 from 23968511 to 23982103 in GRCr8 per NCBI blast - see attachment for sequence annotation. Currently live colony with Dr. Anne Kwitek at the Medical College of Wisconsin. Being cryopreserved and the live colony will not be available. 630350551 mutant Rat Genome Database (RGD) RGD Live Animals (as of 2026-01-14) 630350551 2026-09-05 06:52:47 0
SD-Dmdem1Ins
 
Resource Report
Resource Website
RRID:RGD_630350396 Rattus norvegicus Deletion of exons 45 to 47 of the rat Dmd gene by CRISPR/Cas9 was performed by using two pairs of sgRNAs on both sides of exons 45 and 47. The spCas9 and sgRNAs were electroporated in rat Sprague Dawley (RjHan:SD) fertilized oocytes. Genotyping PCR and sequencing were used to confirm the deletion of exons 45–47 in F0 founder animals. Rats can be obtained through material transfer agreement by contacting the corresponding author at valentina.- [email protected] and [email protected]. 630350396 mutant Rat Genome Database (RGD) RGD Unknown 630350396 2026-09-05 06:52:47 0
SD-Tlr4em6Mcwi
 
Resource Report
Resource Website
RRID:RGD_404976869 Rattus norvegicus CRISPR/Cas9 system was used to introduce a mutation in the Tlr4 gene of Crl:SD rat embryos. The resulting mutation is a 14-bp deletion in exon 2; rn7:chr5:80,151,447-80,151,460. Contact MCW rat distribution at [email protected] 404976869 mutant Rat Genome Database (RGD) RGD Cryopreserved Sperm (as of 2024-03-18) 404976869 2026-09-05 06:52:47 0
SS-Shc1em6Mcwi
 
Resource Report
Resource Website
RRID:RGD_124715482 Rattus norvegicus Generated by pronuclear injection of a CRISPR plasmid expressing Cas9 and single-guide RNA targeting the sequence CACTCAGCTTGTTCATGTCCTGG (protospacer adjacent motif underlined) into one-cell SS (SS/JrHsdMcwi) rat embryos. This model harbors a 6-bp deletion (mRatBN7.2 chr2:174,841,367-174,841,372) including the p52SHC initiation codon. Contact MCW rat distribution at [email protected] 124715482 mutant Rat Genome Database (RGD) RGD Unknown 124715482 2026-09-05 06:52:48 0
SD-Dbhem1(cre)Xyan
 
Resource Report
Resource Website
RRID:RGD_632518356 Rattus norvegicus DBH-Cre knock-in (KI) rats, developed on the Sprague Dawley (SD) rat background, were generated using the CRISPR/Cas9 system. In this knock-in model, a gene cassette encod- ing 2A peptide, fused to Cre recombinase was introduced to replace the TAA stop codon in exon 12 of the rat Dbh gene. Additionally, a synonymous mutation p. T616= (ACG to ACA) was incorporated to pre- vent gRNA binding and recutting of the sequence following homology-directed repair. The gRNA targeting the rat DBH gene (gRNA-B1: 5′-TTACTCAGTGTCTGCCTCCGTGG-3′), the donor vector con- taining the “P2A-Cre” cassette, and a synonymous mutation p. T616= (ACG to ACA), along with Cas9 mRNA, were co-injected into fertilized rat embryos. F0 founders. DBH-Cre KI rats were bred with wild-type SD rats (Guangdong Vital River Laboratory Animal Technology Co., Ltd., China). Shenzhen Institute of Advanced Technolog, Shenzhen, China 632518356 mutant Rat Genome Database (RGD) RGD Unknown 632518356 2026-09-05 06:52:47 0
WAG-Cd247em9Mcwi
 
Resource Report
Resource Website
RRID:RGD_152985692 Rattus norvegicus CRISPR/Cas9 mutagenesis was used to knockout Cd247 in the WAG/RijCmcr (WAG) strain. A single guide RNA (sgRNA) targeting the Cd247 exon 2 sequence GATGGAATCCTCTTCATCTACGG (protospacer adjacent motif in bold) was injected along with SpCas9 protein into one-cell WAG embryos. A founder offspring harboring a 17-bp frame-shift indel mutation deleting GAATCCTCTTCATCTAC (rn6.0 chr13:84,064,185-84,064,201) was identified and confirmed by Sanger sequencing. The frameshift mutation is predicted to cause a premature truncation of the normal 165 amino acid protein coding sequence after only 37 amino acids, lacking most of the transmembrane and the entirety of the external cellular protein domains. Contact MCW rat distribution at [email protected]. 152985692 mutant Rat Genome Database (RGD) RGD Live Animals (as of 2022-06-08) 152985692 2026-09-05 06:52:47 0

Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.