Organisms   Select Another Resource Report Type

http://www.wormbase.org/db/get?name=WBStrain00051730

Source Database: WormBase (WB)
Affected Genes: WBGene00001196(egl-30)
Genomic Alteration: WBGene00001196(egl-30)
Availability: unknown
Source References: EMPTY
Synonyms: egl-30(pe914) I.
Notes: Presumptive gain-of-function mutant shows defects in salt-food associative learning and olfactory learning. Reference: Tomioka M, et al. 2006 Sep 7;51(5):613-25. PMID: 16950159

Proper citation: RRID:WB-STRAIN:WBStrain00051730 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051696

Source Database: WormBase (WB)
Affected Genes: WBGene00000216(asp-3)
Genomic Alteration: WBGene00000216(asp-3)
Availability: unknown
Source References: EMPTY
Synonyms: asp-3(utx47[mNG::3xFlag::asp-3]) X.
Notes: Made_by: Stephen Pullman (Glow Worms '21)|"N-terminal tag of ASP-3 via CRISPR/Cas9 knock-in of mNeonGreen at asp-3 locus. Insertion verified by PCR and fluorescence. Left flank: 5' gcgctgcttctcaattagtgataacgcacc 3'; Right flank: 5' ATGTCGGGCCGCGTTTTCCTTCTTCTGGCT 3'; sgRNA: tagtgataacgcaccATGT (19 bp); Cas9/sgRNA plasmid: pGLOW74; mNG^SEC^3xFlag plasmid: pGLOW96; SEC insertion allele strain: GLW58."

Proper citation: RRID:WB-STRAIN:WBStrain00051696 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051735

Source Database: WormBase (WB)
Affected Genes: WBGene00000898(daf-2)
Genomic Alteration: WBGene00000898(daf-2)
Availability: unknown
Source References: EMPTY
Synonyms: daf-2(pe1230) III.
Notes: Daf-c phenotype at 25C; normal development at 20C. Defects in salt-starve associative learning and olfactory learning. Reference: Ohno H, et al. Science. 2014 Jul 18;345(6194):313-7. PMID: 25035490

Proper citation: RRID:WB-STRAIN:WBStrain00051735 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051734

Source Database: WormBase (WB)
Affected Genes: WBGene00000913(daf-18)
Genomic Alteration: WBGene00000913(daf-18)
Availability: unknown
Source References: EMPTY
Synonyms: daf-18(pe408) IV.
Notes: pe408 suppresses the defects in salt-starve associative learning of casy-1(tm718). Reference: Ohno H, et al. Science. 2014 Jul 18;345(6194):313-7. PMID: 25035490

Proper citation: RRID:WB-STRAIN:WBStrain00051734 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051699

Source Database: WormBase (WB)
Affected Genes: WBGene00002230(klp-20)|WBGene00006960(xbx-1)|WBGene00017973(ift-81)
Genomic Alteration: WBGene00002230(klp-20), WBGene00006960(xbx-1), WBGene00017973(ift-81)
Availability: unknown
Source References: EMPTY
Synonyms: klp-20(cas447[klp-20::gfp]) III; xbx-1(cas502[xbx-1::tagRFP]) V; ift-81(cas498[ift-81::tagBFP]) X.
Notes: Constructed by crossing individual fluorescence knock-in worms. GFP inserted into the endogenous klp-20 gene at its C-terminus, tagRFP::3xFlag inserted into the endogenous xbx-1 gene at its C-terminus and tagBFP inserted into the endogenous ift-81 gene at its C-terminus by Cas9-triggered homologous recombination. GFP enriched at the proximal region (middle segment) of amphid or phasmid sensory cilia while red and blue fluorescence enriched along the whole cilia. Very weak fluorescence in the cell bodies of ciliated neurons.

Proper citation: RRID:WB-STRAIN:WBStrain00051699 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051732

Source Database: WormBase (WB)
Affected Genes: WBGene00004036(plc-1)
Genomic Alteration: WBGene00004036(plc-1)
Availability: unknown
Source References: EMPTY
Synonyms: plc-1(pe1238) X.
Notes: Made_by: Iwata R.|"Presumptive null allele of plc-1. Shows a preference for low salt concentrations. Reference: Kunitomo H, et al., 2013, Nat Commun. 2013;4:2210. doi: 10.1038/ncomms3210."

Proper citation: RRID:WB-STRAIN:WBStrain00051732 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051737

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: peIs2113.
Notes: Made_by: Jang Moon Sun|"peIs2113 [gcy-21p::mCaspase + tax-4p::NLS::YC2.60 + lin-44p::GFP]. Genetic ablation of ASG neurons by specific expression of caspase. tax-4p::YC2.60 facilitates calcium imaging. Reference: Jang MS, et al. Proc Natl Acad Sci U S A. 2019 Sep 10;116(37):18673-18683. PMID: 31455735"

Proper citation: RRID:WB-STRAIN:WBStrain00051737 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051683

Source Database: WormBase (WB)
Affected Genes: WBGene00001073(dpy-11)|WBGene00006761(unc-24)|WBGene00008140(xpf-1)|WBGene00008346(C56A3.8)
Genomic Alteration: WBGene00001073(dpy-11), WBGene00006761(unc-24), WBGene00008140(xpf-1), WBGene00008346(C56A3.8)
Availability: unknown
Source References: EMPTY
Synonyms: xpf-1(e1487) II; unc-24(e138)/nt1[let (m435)] IV; dpy-11(e224) C56A3.8(t2055)/nt1[let (m435)] V.
Notes: him-9 is other name for xpf-1|"Made_by: Vancouver KO Group"|"Maternal effect lethal mutation linked to dpy-11(e224) and pseudolinked to unc-24(e138), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t2055 homozygotes that produce unfertilized oocytes. GE2886 is also homozygous for him-9(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation."|"Maternal effect lethal mutation linked to dpy-11(e224) and pseudolinked to unc-24(e138), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t2055 homozygotes that produce unfertilized oocytes. GE2886 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9."

Proper citation: RRID:WB-STRAIN:WBStrain00051683 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051682

Source Database: WormBase (WB)
Affected Genes: WBGene00001073(dpy-11)|WBGene00006761(unc-24)|WBGene00008140(xpf-1)|WBGene00020675(spe-51)
Genomic Alteration: WBGene00001073(dpy-11), WBGene00006761(unc-24), WBGene00008140(xpf-1), WBGene00020675(spe-51)
Availability: unknown
Source References: EMPTY
Synonyms: xpf-1(e1487) II; unc-24(e138) T22B11.1(t1786)/nt1[let (m435)] IV; dpy-11(e224)/nt1[let (m435)] V.
Notes: him-9 is other name for xpf-1|"Made_by: Vancouver KO Group"|"Temperature-sensitive maternal effect lethal mutation linked to unc-24(e138) and pseudolinked to dpy-11(e224), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t1786 homozygotes that produce unfertilized oocytes at restrictive temperature. GE2827 is also homozygous for him-9(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation."|"Temperature-sensitive maternal effect lethal mutation linked to unc-24(e138) and pseudolinked to dpy-11(e224), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t1786 homozygotes that produce unfertilized oocytes at restrictive temperature. GE2827 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9."

Proper citation: RRID:WB-STRAIN:WBStrain00051682 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051681

Source Database: WormBase (WB)
Affected Genes: WBGene00001073(dpy-11)|WBGene00006761(unc-24)|WBGene00008140(xpf-1)|WBGene00008346(C56A3.8)
Genomic Alteration: WBGene00001073(dpy-11), WBGene00006761(unc-24), WBGene00008140(xpf-1), WBGene00008346(C56A3.8)
Availability: unknown
Source References: EMPTY
Synonyms: xpf-1(e1487) II; unc-24(e138)/nt1[let (m435)] IV; dpy-11(e224) C56A3.8(t2029)/nt1[let (m435)] V.
Notes: him-9 is other name for xpf-1|"Made_by: Vancouver KO Group"|"Maternal effect lethal mutation linked to dpy-11(e224) and pseudolinked to unc-24(e138), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t2029 homozygotes that produce unfertilized oocytes. GE2734 is also homozygous for him-9(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation."|"Maternal effect lethal mutation linked to dpy-11(e224) and pseudolinked to unc-24(e138), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t2029 homozygotes that produce unfertilized oocytes. GE2734 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9."

Proper citation: RRID:WB-STRAIN:WBStrain00051681 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051686

Source Database: WormBase (WB)
Affected Genes: WBGene00001946(his-72)|WBGene00006843(unc-119)
Genomic Alteration: WBGene00001946(his-72), WBGene00006843(unc-119)
Availability: unknown
Source References: EMPTY
Synonyms: muIs252 II; unc-119(ed3) his-72(utx21[his-72::wrmScarlet11::3xMyc]) III.
Notes: Made_by: Ella DeMott (Glow Worms '20)|"muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. C-terminal tag of HIS-72 via CRISPR/Cas9 knock-in of wrmScarlet11 into endogenous his-72 locus. Genetic background: strain CF4582. Insertion verified by PCR and fluorescence. Left flank: 5' CTCGCCAGACGCATTCGCGGAGAACGTGCT 3' (one silent mutation); Right flank: 5' TAAgctccatcaccaattctcgaagcactt 3'; sgRNA: GAGCTTAAGCACGTTCTCCG; Cas9/sgRNA plasmid: pGLOW87; wrmScarlet11^SEC^3xMyc plasmid: pGLOW88; SEC insertion allele strain: GLW26"

Proper citation: RRID:WB-STRAIN:WBStrain00051686 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051724

Source Database: WormBase (WB)
Affected Genes: WBGene00000528(clh-1)
Genomic Alteration: WBGene00000528(clh-1)
Availability: unknown
Source References: EMPTY
Synonyms: clh-1(pe572) II.
Notes: Made_by: Park C.|"pe572 mutants exhibit defects in salt chemotaxis after low salt concentration with food conditioning. Reference: Park C, et al. Elife. 2021 Jan 25;10:e55701. doi: 10.7554/eLife.55701. PMID: 33492228"

Proper citation: RRID:WB-STRAIN:WBStrain00051724 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051689

Source Database: WormBase (WB)
Affected Genes: WBGene00020481(gldi-2)
Genomic Alteration: WBGene00020481(gldi-2)
Availability: unknown
Source References: EMPTY
Synonyms: gldi-2(utx27[mNG::3xFlag::T13C2.6]) II.
Notes: Made_by: Staci Guillen (Glow Worms '21)|"T13C2.6. N-terminal tag of T13C2.6 via CRISPR/Cas9 knock-in of mNeonGreen at gldi-2 locus. Insertion verified by PCR and fluorescence. Left flank: 5' aaatattaattgataatcagaggagtaaaa 3'; Right flank: 5' ATGAGGACATGTCTCACCCTCACGGGTTTC 3'; sgRNA: taatcagaggagtaaaaATG; Cas9/sgRNA plasmid: pGLOW45; mNG^SEC^3xFlag plasmid: pGLOW54; SEC insertion allele strain: GLW34."

Proper citation: RRID:WB-STRAIN:WBStrain00051689 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051688

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: T28D6.6(utx25[T28D6.6::mNG::3xFlag]) III.
Notes: Made_by: Skye Waterland (Glow Worms '20)|"Superficially wild type. C-terminal tag of T28D6.6 via CRISPR/Cas9 knock-in of mNeonGreen at T28D6.6 locus. Insertion verified by PCR and fluorescence. Left flank: 5' gtcgcaaataatggttttttttccagAGTC 3'; Right flank: 5' TAAgctgaaattcccgtgcttctcgtcttc 3'; sgRNA: gggaatttcagcTTAGACTc; Cas9/sgRNA plasmid: pGLOW2; mNG^SEC^3xFlag plasmid: pGLOW42; SEC insertion allele strain: GLW32. Reference: Huang et al. 2021. Improved CRISPR/Cas9 knock-in efficiency via the self-excising cassette (SEC) selection method in C. elegans. 2021 Sep 16;2021:10.17912/micropub.biology.000460. doi: 10.17912/micropub.biology.000460. eCollection 2021."

Proper citation: RRID:WB-STRAIN:WBStrain00051688 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051728

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: peIs580.
Notes: peIs580 [ins-1p(short)::casp1 + ins-1p(short)::Venus + unc-122p::GFP]. AIA neurons are ablated by specific expression of caspase. Reference: Kunitomo H, et al., 2013, Nat Commun. 2013;4:2210. doi: 10.1038/ncomms3210.

Proper citation: RRID:WB-STRAIN:WBStrain00051728 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051727

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: peIs579.
Notes: peIs579 [ttx-3p::casp1 + ttx-3p::Venus + lin-44p::GFP]. AIY neurons are ablated by specific expression of caspase. Reference: Kunitomo H, et al., 2013, Nat Commun. 2013;4:2210. doi: 10.1038/ncomms3210.

Proper citation: RRID:WB-STRAIN:WBStrain00051727 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051725

Source Database: WormBase (WB)
Affected Genes: WBGene00000528(clh-1)
Genomic Alteration: WBGene00000528(clh-1)
Availability: unknown
Source References: EMPTY
Synonyms: clh-1(pe577) II.
Notes: Made_by: Park C.|"pe577 mutants exhibit defects in salt chemotaxis after low salt concentration with food conditioning. Reference: Park C, et al. Elife. 2021 Jan 25;10:e55701. doi: 10.7554/eLife.55701. PMID: 33492228"

Proper citation: RRID:WB-STRAIN:WBStrain00051725 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051729

Source Database: WormBase (WB)
Affected Genes: WBGene00001648(goa-1)
Genomic Alteration: WBGene00001648(goa-1)
Availability: unknown
Source References: EMPTY
Synonyms: goa-1(pe773) I.
Notes: Made_by: Sakai N.|"This strain shows a preference for high salt concentration when conditioned with food. Reference: Ohno H, et al. Cell Rep. 2017 Sep 5;20(10):2294-2303. PMID: 28877465"

Proper citation: RRID:WB-STRAIN:WBStrain00051729 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051676

Source Database: WormBase (WB)
Affected Genes: WBGene00001073(dpy-11)|WBGene00006761(unc-24)|WBGene00008140(xpf-1)|WBGene00009186(trcs-1)
Genomic Alteration: WBGene00001073(dpy-11), WBGene00006761(unc-24), WBGene00008140(xpf-1), WBGene00009186(trcs-1)
Availability: unknown
Source References: EMPTY
Synonyms: xpf-1(e1487) II; unc-24(e138) trcs-1(t1909)/nT1[let (m435)] IV; dpy-11(e224)/nT1[let (m435)] V.
Notes: him-9 is other name for xpf-1|"Leaky temperature-sensitive maternal effect lethal mutation linked to unc-24(e138) and pseudolinked to dpy-11(e224), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t1909 homozygotes that produce dead eggs at restrictive temperature. GE2512 is also homozygous for him-9(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation."|"Leaky temperature-sensitive maternal effect lethal mutation linked to unc-24(e138) and pseudolinked to dpy-11(e224), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t1909 homozygotes that produce dead eggs at restrictive temperature. GE2512 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9."|"Made_by: Vancouver KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00051676 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051675

Source Database: WormBase (WB)
Affected Genes: WBGene00001073(dpy-11)|WBGene00006761(unc-24)|WBGene00008140(xpf-1)|WBGene00016955(perm-5)
Genomic Alteration: WBGene00001073(dpy-11), WBGene00006761(unc-24), WBGene00008140(xpf-1), WBGene00016955(perm-5)
Availability: unknown
Source References: EMPTY
Synonyms: xpf-1(e1487) II; unc-24(e138) perm-5(t1900)/nT1[let (m435)] IV; dpy-11(e224)/nT1[let (m435)] V.
Notes: him-9 is other name for xpf-1|"Made_by: Vancouver KO Group"|"Maternal effect lethal mutation linked to unc-24(e138) and pseudolinked to dpy-11(e224), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t1900 homozygotes that produce dead embryos. GE2453 is also homozygous for him-9(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation."|"Maternal effect lethal mutation linked to unc-24(e138) and pseudolinked to dpy-11(e224), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t1900 homozygotes that produce dead embryos. GE2453 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9."

Proper citation: RRID:WB-STRAIN:WBStrain00051675 Copy   

•   Source: Integrated Animals