Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00051546
Source Database: WormBase (WB)
Affected Genes: WBGene00007346(frpr-2)
Genomic Alteration: WBGene00007346(frpr-2)
Availability: unknown
Source References: PMID:34741504
Synonyms: frpr-2(sy1364) X.
Notes: Batch Strain object requested via get_NS_ids.pl|"Made_by: Heenam Park"|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of frpr-2. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GTTATGCGTGAGTGTGAATGCCTTCATGAGCCGATA right flanking sequence: GAGGGGTACGCGGGAGTTGCCAATCTGgtaagtatac inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ACTCCCGCGTACCCCTCTAT Method Reference: G3 (Bethesda).2018 Nov 6;8(11):3607-3616"
Proper citation: RRID:WB-STRAIN:WBStrain00051546 Copy
http://www.wormbase.org/db/get?name=WBStrain00051545
Source Database: WormBase (WB)
Affected Genes: WBGene00018728(frpr-8)
Genomic Alteration: WBGene00018728(frpr-8)
Availability: unknown
Source References: PMID:34741504
Synonyms: frpr-8(sy1363)
Notes: Batch Strain object requested via get_NS_ids.pl
Proper citation: RRID:WB-STRAIN:WBStrain00051545 Copy
http://www.wormbase.org/db/get?name=WBStrain00051549
Source Database: WormBase (WB)
Affected Genes: WBGene00019496(frpr-14)
Genomic Alteration: WBGene00019496(frpr-14)
Availability: unknown
Source References: PMID:34741504
Synonyms: syEx1785 [Pfrpr-14::frpr-14 gDNA::SL2::GFP, Pnpr-9::mCherry-H2B, Pofm-1::RFP]; sy1301
Notes: Batch Strain object requested via get_NS_ids.pl
Proper citation: RRID:WB-STRAIN:WBStrain00051549 Copy
http://www.wormbase.org/db/get?name=WBStrain00051652
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: unknown
Source References: EMPTY
Synonyms: unc-119(ox819 oxTi1126) III.
Notes: oxTi1126 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + myo-2p::2xNLS::cyOFP::let-858 3'UTR + lox2272] III. Knock-in into previously modified unc-119(ox819) endogenous locus. Cas9 insertion marked with myo-2p::cyOFP (cyan-excitable Orange Fluorescent Protein), a long-Stokes-shift fluorescent protein that is spectrally separable from common green and red fluorophores. The Cas9 transgene was optimized for germline expression by including 4 large PATC-rich introns from smu-2. Lower activity than other Cas9 strains, but useful because Cas9, Cre, and unc-119 are in a single unit. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https:
Proper citation: RRID:WB-STRAIN:WBStrain00051652 Copy
http://www.wormbase.org/db/get?name=WBStrain00051658
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: unknown
Source References: EMPTY
Synonyms: unc-119(ox819) III; W03F9.11(oxTi1121) V.
Notes: oxTi1121 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + lox2272]) V. The Cas9 transgene was optimized for germline expression by including 4 large PATC-rich introns from smu-2. Inserted into W03F9.11. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https:
Proper citation: RRID:WB-STRAIN:WBStrain00051658 Copy
http://www.wormbase.org/db/get?name=WBStrain00051656
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: unknown
Source References: EMPTY
Synonyms: W01A8.6(oxTi1128) I; unc-119(ox819) III.
Notes: oxTi1128 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + myo-2p::2xNLS::cyOFP::let-858 3'UTR + lox2272]) I. Cas9 insertion marked with myo-2p::cyOFP (cyan-excitable Orange Fluorescent Protein), a long-Stokes-shift fluorescent protein that is spectrally separable from common green and red fluorophores. Inserted into W01A8.6. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https:
Proper citation: RRID:WB-STRAIN:WBStrain00051656 Copy
http://www.wormbase.org/db/get?name=WBStrain00051641
Source Database: WormBase (WB)
Affected Genes: WBGene00006831(unc-104)
Genomic Alteration: WBGene00006831(unc-104)
Availability: unknown
Source References: EMPTY
Synonyms: reSi7 I; unc-104(knu973[unc-104::AID]) II.
Notes: Made_by: Cori K. Cahoon|"reSi7 [rgef-1p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Neuronal-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in neuronal nuclei. Auxin-inducible degradation (AID) tag inserted at C-terminus of endogenous unc-104 locus by CRISPR/Cas9. Can be used for auxin-induced immobilization of worms for live imaging. Strain generated by crossing endogenously tagged unc-104::AID into DV3805. reSi7 is at -5.32 cM. References: Cahoon CK and Libuda DE. bioRxiv 2021.05.25.445686; doi: https:"
Proper citation: RRID:WB-STRAIN:WBStrain00051641 Copy
http://www.wormbase.org/db/get?name=WBStrain00051640
Source Database: WormBase (WB)
Affected Genes: WBGene00006757(unc-18)
Genomic Alteration: WBGene00006757(unc-18)
Availability: unknown
Source References: EMPTY
Synonyms: wrdSi23 I; unc-18(knu969[unc-18::AID]) X.
Notes: Made_by: Cori K. Cahoon|"wrdSi23 [eft-3p::TIR1:F2A:mTagBFP:tbb2 3' UTR:: loxP] I. wrdSi23 is inserted at ttTi4348 (I: -5.32 cM). Pan-somatic expression of TIR1 co-factor for AID, and expression of AID-tagged blue protein in somatic nuclei. Auxin-inducible degradation (AID) tag inserted at C-terminus of endogenous unc-18 locus by CRISPR/Cas9. Can be used for auxin-induced immobilization of worms for live imaging. References: Cahoon CK and Libuda DE. bioRxiv 2021.05.25.445686; doi: https:"
Proper citation: RRID:WB-STRAIN:WBStrain00051640 Copy
http://www.wormbase.org/db/get?name=WBStrain00051646
Source Database: WormBase (WB)
Affected Genes: WBGene00001946(his-72)|WBGene00003401(mpk-1)
Genomic Alteration: WBGene00001946(his-72), WBGene00003401(mpk-1)
Availability: unknown
Source References: EMPTY
Synonyms: his-72(cp76[mNeonGreen::3xFlag::his-72]) mpk-1(re172[mpk-1::mKate2::3xFlag]) III.
Notes: Green nuclei and ubiquitous cytosolic red expression, typically excluded from nuclei but with activity-dependent translocation into nuclei. Derived in an N2 background.C-terminally tagged mpk-1 is detectable by triplex PCR:mpk-1 genotyping FW: ACCAAAACAACCATGGGCTCGmpk-1 genotyping RV-1: GCTCCAAGTATGGGTGAGCCmpk-1 genotyping RV-2: GGTTCCCTCGTATGGCTTTCCReference: Neal R, et al. (2021). Nuclear translocation of tagged endogenous ERK/MPK-1 MAP Kinase denotes a subset of activation events in C. elegans development.|"Made_by: Neal Rasmussen"
Proper citation: RRID:WB-STRAIN:WBStrain00051646 Copy
http://www.wormbase.org/db/get?name=WBStrain00051645
Source Database: WormBase (WB)
Affected Genes: WBGene00006751(unc-11)
Genomic Alteration: WBGene00006751(unc-11)
Availability: unknown
Source References: EMPTY
Synonyms: unc-11(vg103[unc-11::GFP]) I.
Notes: Superficially wild-type. Endogenously-tagged UNC-11::GFP is expressed in most, if not all, neurons, epithelial cells and coelomocytes, and should be visible in the nerve ring through a dissecting scope..
Proper citation: RRID:WB-STRAIN:WBStrain00051645 Copy
http://www.wormbase.org/db/get?name=WBStrain00051644
Source Database: WormBase (WB)
Affected Genes: WBGene00015814(oatr-1)
Genomic Alteration: WBGene00015814(oatr-1)
Availability: unknown
Source References: EMPTY
Synonyms: orn-1(tm5454) III.
Notes: Reference: Bailly AP, et al. Cell Rep. 2019 Oct 1;29(1):212-224.e8. doi: 10.1016/j.celrep.2019.08.070. PMID: 31577950
Proper citation: RRID:WB-STRAIN:WBStrain00051644 Copy
http://www.wormbase.org/db/get?name=WBStrain00051649
Source Database: WormBase (WB)
Affected Genes: WBGene00021811(ral-1)
Genomic Alteration: WBGene00021811(ral-1)
Availability: unknown
Source References: EMPTY
Synonyms: ral-1(re218[mKate2::3xFlag::ral-1]) III.
Notes: Made_by: Hanna Shin|"Ubiquitous expression and localization to plasma membranes. Derived in an N2 background. TD185 5 -GCCGGAAGAGTGATGAACCC- 3 TD186 5 -TAATGAGCTCGGAGACCATGGC- 3TD187 5 -CGCACCTCATCATACATGAACTGC- 3 Reference: Shin H, et al. Cell Rep. 2018 Sep 4;24(10):2669-2681. PMID: 30184501"
Proper citation: RRID:WB-STRAIN:WBStrain00051649 Copy
http://www.wormbase.org/db/get?name=WBStrain00051639
Source Database: WormBase (WB)
Affected Genes: WBGene00006831(unc-104)
Genomic Alteration: WBGene00006831(unc-104)
Availability: unknown
Source References: PMID:37651423
Synonyms: wrdSi23 I; unc-104(knu973[unc-104::AID]) II.
Notes: Made_by: Cori K. Cahoon|"Supplementary_genotype wrdSi23 [eft-3p::TIR1:F2A:mTagBFP:tbb2 3' UTR:: loxP] I; unc-104(knu973[unc-104::AID]) II"|"wrdSi23 [eft-3p::TIR1:F2A:mTagBFP:tbb2 3' UTR:: loxP] I. wrdSi23 is inserted at ttTi4348 (I: -5.32 cM). Pan-somatic expression of TIR1 co-factor for AID, and expression of AID-tagged blue protein in somatic nuclei. Auxin-inducible degradation (AID) tag inserted at C-terminus of endogenous unc-104 locus by CRISPR/Cas9. Can be used for auxin-induced immobilization of worms for live imaging. References: Cahoon CK and Libuda DE. bioRxiv 2021.05.25.445686; doi: https:"
Proper citation: RRID:WB-STRAIN:WBStrain00051639 Copy
http://www.wormbase.org/db/get?name=WBStrain00051690
Source Database: WormBase (WB)
Affected Genes: WBGene00014204(ccdc-47)
Genomic Alteration: WBGene00014204(ccdc-47)
Availability: unknown
Source References: EMPTY
Synonyms: ccdc-47(utx31[mNG::3xFlag::ccdc-47]) III.
Notes: Made_by: Anita Rhodes (Glow Worms '20)|"N-terminal tag of CCDC-47 via CRISPR/Cas9 knock-in of mNeonGreen at ccdc-47 locus. Insertion verified by PCR, Sanger sequencing, and fluorescence. Left flank: 5' gttaaatcactcaatttcgggtcgttcacc 3'; Right flank: 5' ATGAAGATAGTATGGATTTTCCTAATATTC 3' (3 silent mutations); sgRNA: cgttcaccATGAAAATCGTC; Cas9/sgRNA plasmid: pGLOW13; mNG^SEC^3xFlag plasmid: pGLOW17; SEC insertion allele strain (balanced): GLW38."
Proper citation: RRID:WB-STRAIN:WBStrain00051690 Copy
http://www.wormbase.org/db/get?name=WBStrain00051694
Source Database: WormBase (WB)
Affected Genes: WBGene00002008(hsp-4)
Genomic Alteration: WBGene00002008(hsp-4)
Availability: unknown
Source References: EMPTY
Synonyms: hsp-4(utx39[hsp-4::mNG::3xFlag]) II.
Notes: C-terminal tag of HSP-4 via CRISPR/Cas9 knock-in of mNeonGreen at hsp-4 locus. Insertion verified by PCR and fluorescence. Left flank: 5' TCGGCCGGAGGACAAGGAGAACAAGCTTCTGAGGAGCCATCGGAGGATCATGATGAACTG 3' (1 silent mutation); Right flank: 5' TAAaatattaattgccttcaactacttgct 3'; sgRNA: CGTCTCCAAACTTTACTCGG; Cas9/sgRNA plasmid: pGLOW44; mNG^SEC^3xFlag plasmid: pGLOW61; SEC insertion allele strain: GLW46.|"Made_by: Quincy Martin (Glow Worms '21)"
Proper citation: RRID:WB-STRAIN:WBStrain00051694 Copy
http://www.wormbase.org/db/get?name=WBStrain00051693
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: ZK1058.9(utx37[ZK1058.9::mNG::3xFlag]) III
Notes: C-terminal tag of ZK1058.9 via CRISPR/Cas9 knock-in of mNeonGreen at ZK1058.9 locus. Insertion verified by PCR and fluorescence. Left flank: 5' AGCTCAACGGCTAGCTGGTCTCGTTATTAT 3' (1 silent mutation); Right flank: 5' TAAtgaattttcctccaacttttgtcctct 3'; sgRNA: AATAACGAGACCAGCTAG (18 bp); Cas9/sgRNA plasmid: pGLOW58; mNG^SEC^3xFlag plasmid: pGLOW68; SEC insertion allele strain: GLW44.|"Made_by: Dan Tatulescu (Glow Worms '21)"
Proper citation: RRID:WB-STRAIN:WBStrain00051693 Copy
http://www.wormbase.org/db/get?name=WBStrain00051692
Source Database: WormBase (WB)
Affected Genes: WBGene00011036(edc-3)
Genomic Alteration: WBGene00011036(edc-3)
Availability: unknown
Source References: EMPTY
Synonyms: edc-3(utx35[mNG::3xFlag::edc-3]) I.
Notes: Made_by: Diya Sharma (Glow Worms '21)|"N-terminal tag of EDC-3 via CRISPR/Cas9 knock-in of mNeonGreen at edc-3 locus. Insertion verified by PCR and fluorescence. Left flank: 5' ggttccaattcttctgatttcaaattaaaa 3'; Right flank: 5' ATGGATGACAAACTCATTGGAAGCGTCATCTCTACGGAGACAAAGGACGG 3' (7 silent mutations); sgRNA: ATATCAACCGAAACTAAAGA; Cas9/sgRNA plasmid: pGLOW81; mNG^SEC^3xFlag plasmid: pGLOW103; SEC insertion allele strain: GLW42."
Proper citation: RRID:WB-STRAIN:WBStrain00051692 Copy
http://www.wormbase.org/db/get?name=WBStrain00051691
Source Database: WormBase (WB)
Affected Genes: WBGene00003607(nhr-8)
Genomic Alteration: WBGene00003607(nhr-8)
Availability: unknown
Source References: EMPTY
Synonyms: nhr-8(utx33[mNG::3xFlag::nhr-8]) IV.
Notes: Made_by: Gillian Witten (Glow Worms '21)|"N-terminal tag of NHR-8 via CRISPR/Cas9 knock-in of mNeonGreen at nhr-8 locus. Insertion verified by PCR and Sanger sequencing. Left flank: 5' taatcactaaaacaaaaatttcgtcattcc 3'; Right flank: 5' ATGCCTTCGTCTTCTCCATCGATGGACGAG 3'; sgRNA: CGATGGAGAAGACGAAGGCA; Cas9/sgRNA plasmid: pGLOW55; mNG^SEC^3xFlag plasmid: pGLOW56; SEC insertion allele strain: GLW40."
Proper citation: RRID:WB-STRAIN:WBStrain00051691 Copy
http://www.wormbase.org/db/get?name=WBStrain00051698
Source Database: WormBase (WB)
Affected Genes: WBGene00004931(sod-2)
Genomic Alteration: WBGene00004931(sod-2)
Availability: unknown
Source References: EMPTY
Synonyms: sod-2(utx53[mScarlet::3xMyc::sod-2]) I.
Notes: Made_by: Param Kapoor (Glow Worms '21)|"N-terminal tag of SOD-2 via CRISPR/Cas9 knock-in of mScarlet at sod-2 locus. Insertion verified by PCR and fluorescence. Left flank: 5' attgaatattttaattatttgcagccgaaa 3'; Right flank: 5' ATGCTTCAAAACACGGTTCGCTGTGTCTCA 3 (1 silent mutation); sgRNA: AAGCTTTGAGACACAGCGAA; Cas9/sgRNA plasmid: pGLOW98; mScarlet^SEC^3xMyc plasmid: pGLOW111; SEC insertion allele strain: GLW64."
Proper citation: RRID:WB-STRAIN:WBStrain00051698 Copy
http://www.wormbase.org/db/get?name=WBStrain00051697
Source Database: WormBase (WB)
Affected Genes: WBGene00004143(pqn-59)
Genomic Alteration: WBGene00004143(pqn-59)
Availability: unknown
Source References: EMPTY
Synonyms: pqn-59(utx51[mNG::3xFlag::pqn-59]) I.
Notes: Made_by: Persephone Alicea (Glow Worms '20)|"N-terminal tag of PQN-59 via CRISPR/Cas9 knock-in of mNeonGreen at pqn-59 locus. Insertion verified by PCR and fluorescence. Left flank: 5' gaccctttttatttataatttgttttcaga 3'; Right flank: 5' ATGGGTATTAAAGGCGACAAAAAAGCTACT 3 (1 silent mutation); sgRNA: TGCAAGTCGCGCTTGATCGC; Cas9/sgRNA plasmid: pGLOW23; mNG^SEC^3xFlag plasmid: pGLOW24; SEC insertion allele strain (balanced): GLW62."
Proper citation: RRID:WB-STRAIN:WBStrain00051697 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.