Organisms   Select Another Resource Report Type

http://www.wormbase.org/db/get?name=WBStrain00051546

Source Database: WormBase (WB)
Affected Genes: WBGene00007346(frpr-2)
Genomic Alteration: WBGene00007346(frpr-2)
Availability: unknown
Source References: PMID:34741504
Synonyms: frpr-2(sy1364) X.
Notes: Batch Strain object requested via get_NS_ids.pl|"Made_by: Heenam Park"|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of frpr-2. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GTTATGCGTGAGTGTGAATGCCTTCATGAGCCGATA right flanking sequence: GAGGGGTACGCGGGAGTTGCCAATCTGgtaagtatac inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ACTCCCGCGTACCCCTCTAT Method Reference: G3 (Bethesda).2018 Nov 6;8(11):3607-3616"

Proper citation: RRID:WB-STRAIN:WBStrain00051546 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051545

Source Database: WormBase (WB)
Affected Genes: WBGene00018728(frpr-8)
Genomic Alteration: WBGene00018728(frpr-8)
Availability: unknown
Source References: PMID:34741504
Synonyms: frpr-8(sy1363)
Notes: Batch Strain object requested via get_NS_ids.pl

Proper citation: RRID:WB-STRAIN:WBStrain00051545 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051549

Source Database: WormBase (WB)
Affected Genes: WBGene00019496(frpr-14)
Genomic Alteration: WBGene00019496(frpr-14)
Availability: unknown
Source References: PMID:34741504
Synonyms: syEx1785 [Pfrpr-14::frpr-14 gDNA::SL2::GFP, Pnpr-9::mCherry-H2B, Pofm-1::RFP]; sy1301
Notes: Batch Strain object requested via get_NS_ids.pl

Proper citation: RRID:WB-STRAIN:WBStrain00051549 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051652

Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: unknown
Source References: EMPTY
Synonyms: unc-119(ox819 oxTi1126) III.
Notes: oxTi1126 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + myo-2p::2xNLS::cyOFP::let-858 3'UTR + lox2272] III. Knock-in into previously modified unc-119(ox819) endogenous locus. Cas9 insertion marked with myo-2p::cyOFP (cyan-excitable Orange Fluorescent Protein), a long-Stokes-shift fluorescent protein that is spectrally separable from common green and red fluorophores. The Cas9 transgene was optimized for germline expression by including 4 large PATC-rich introns from smu-2. Lower activity than other Cas9 strains, but useful because Cas9, Cre, and unc-119 are in a single unit. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https:

Proper citation: RRID:WB-STRAIN:WBStrain00051652 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051658

Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: unknown
Source References: EMPTY
Synonyms: unc-119(ox819) III; W03F9.11(oxTi1121) V.
Notes: oxTi1121 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + lox2272]) V. The Cas9 transgene was optimized for germline expression by including 4 large PATC-rich introns from smu-2. Inserted into W03F9.11. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https:

Proper citation: RRID:WB-STRAIN:WBStrain00051658 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051656

Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: unknown
Source References: EMPTY
Synonyms: W01A8.6(oxTi1128) I; unc-119(ox819) III.
Notes: oxTi1128 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + myo-2p::2xNLS::cyOFP::let-858 3'UTR + lox2272]) I. Cas9 insertion marked with myo-2p::cyOFP (cyan-excitable Orange Fluorescent Protein), a long-Stokes-shift fluorescent protein that is spectrally separable from common green and red fluorophores. Inserted into W01A8.6. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https:

Proper citation: RRID:WB-STRAIN:WBStrain00051656 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051641

Source Database: WormBase (WB)
Affected Genes: WBGene00006831(unc-104)
Genomic Alteration: WBGene00006831(unc-104)
Availability: unknown
Source References: EMPTY
Synonyms: reSi7 I; unc-104(knu973[unc-104::AID]) II.
Notes: Made_by: Cori K. Cahoon|"reSi7 [rgef-1p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Neuronal-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in neuronal nuclei. Auxin-inducible degradation (AID) tag inserted at C-terminus of endogenous unc-104 locus by CRISPR/Cas9. Can be used for auxin-induced immobilization of worms for live imaging. Strain generated by crossing endogenously tagged unc-104::AID into DV3805. reSi7 is at -5.32 cM. References: Cahoon CK and Libuda DE. bioRxiv 2021.05.25.445686; doi: https:"

Proper citation: RRID:WB-STRAIN:WBStrain00051641 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051640

Source Database: WormBase (WB)
Affected Genes: WBGene00006757(unc-18)
Genomic Alteration: WBGene00006757(unc-18)
Availability: unknown
Source References: EMPTY
Synonyms: wrdSi23 I; unc-18(knu969[unc-18::AID]) X.
Notes: Made_by: Cori K. Cahoon|"wrdSi23 [eft-3p::TIR1:F2A:mTagBFP:tbb2 3' UTR:: loxP] I. wrdSi23 is inserted at ttTi4348 (I: -5.32 cM). Pan-somatic expression of TIR1 co-factor for AID, and expression of AID-tagged blue protein in somatic nuclei. Auxin-inducible degradation (AID) tag inserted at C-terminus of endogenous unc-18 locus by CRISPR/Cas9. Can be used for auxin-induced immobilization of worms for live imaging. References: Cahoon CK and Libuda DE. bioRxiv 2021.05.25.445686; doi: https:"

Proper citation: RRID:WB-STRAIN:WBStrain00051640 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051646

Source Database: WormBase (WB)
Affected Genes: WBGene00001946(his-72)|WBGene00003401(mpk-1)
Genomic Alteration: WBGene00001946(his-72), WBGene00003401(mpk-1)
Availability: unknown
Source References: EMPTY
Synonyms: his-72(cp76[mNeonGreen::3xFlag::his-72]) mpk-1(re172[mpk-1::mKate2::3xFlag]) III.
Notes: Green nuclei and ubiquitous cytosolic red expression, typically excluded from nuclei but with activity-dependent translocation into nuclei. Derived in an N2 background.C-terminally tagged mpk-1 is detectable by triplex PCR:mpk-1 genotyping FW: ACCAAAACAACCATGGGCTCGmpk-1 genotyping RV-1: GCTCCAAGTATGGGTGAGCCmpk-1 genotyping RV-2: GGTTCCCTCGTATGGCTTTCCReference: Neal R, et al. (2021). Nuclear translocation of tagged endogenous ERK/MPK-1 MAP Kinase denotes a subset of activation events in C. elegans development.|"Made_by: Neal Rasmussen"

Proper citation: RRID:WB-STRAIN:WBStrain00051646 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051645

Source Database: WormBase (WB)
Affected Genes: WBGene00006751(unc-11)
Genomic Alteration: WBGene00006751(unc-11)
Availability: unknown
Source References: EMPTY
Synonyms: unc-11(vg103[unc-11::GFP]) I.
Notes: Superficially wild-type. Endogenously-tagged UNC-11::GFP is expressed in most, if not all, neurons, epithelial cells and coelomocytes, and should be visible in the nerve ring through a dissecting scope..

Proper citation: RRID:WB-STRAIN:WBStrain00051645 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051644

Source Database: WormBase (WB)
Affected Genes: WBGene00015814(oatr-1)
Genomic Alteration: WBGene00015814(oatr-1)
Availability: unknown
Source References: EMPTY
Synonyms: orn-1(tm5454) III.
Notes: Reference: Bailly AP, et al. Cell Rep. 2019 Oct 1;29(1):212-224.e8. doi: 10.1016/j.celrep.2019.08.070. PMID: 31577950

Proper citation: RRID:WB-STRAIN:WBStrain00051644 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051649

Source Database: WormBase (WB)
Affected Genes: WBGene00021811(ral-1)
Genomic Alteration: WBGene00021811(ral-1)
Availability: unknown
Source References: EMPTY
Synonyms: ral-1(re218[mKate2::3xFlag::ral-1]) III.
Notes: Made_by: Hanna Shin|"Ubiquitous expression and localization to plasma membranes. Derived in an N2 background. TD185 5 -GCCGGAAGAGTGATGAACCC- 3 TD186 5 -TAATGAGCTCGGAGACCATGGC- 3TD187 5 -CGCACCTCATCATACATGAACTGC- 3 Reference: Shin H, et al. Cell Rep. 2018 Sep 4;24(10):2669-2681. PMID: 30184501"

Proper citation: RRID:WB-STRAIN:WBStrain00051649 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051639

Source Database: WormBase (WB)
Affected Genes: WBGene00006831(unc-104)
Genomic Alteration: WBGene00006831(unc-104)
Availability: unknown
Source References: PMID:37651423
Synonyms: wrdSi23 I; unc-104(knu973[unc-104::AID]) II.
Notes: Made_by: Cori K. Cahoon|"Supplementary_genotype wrdSi23 [eft-3p::TIR1:F2A:mTagBFP:tbb2 3' UTR:: loxP] I; unc-104(knu973[unc-104::AID]) II"|"wrdSi23 [eft-3p::TIR1:F2A:mTagBFP:tbb2 3' UTR:: loxP] I. wrdSi23 is inserted at ttTi4348 (I: -5.32 cM). Pan-somatic expression of TIR1 co-factor for AID, and expression of AID-tagged blue protein in somatic nuclei. Auxin-inducible degradation (AID) tag inserted at C-terminus of endogenous unc-104 locus by CRISPR/Cas9. Can be used for auxin-induced immobilization of worms for live imaging. References: Cahoon CK and Libuda DE. bioRxiv 2021.05.25.445686; doi: https:"

Proper citation: RRID:WB-STRAIN:WBStrain00051639 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051690

Source Database: WormBase (WB)
Affected Genes: WBGene00014204(ccdc-47)
Genomic Alteration: WBGene00014204(ccdc-47)
Availability: unknown
Source References: EMPTY
Synonyms: ccdc-47(utx31[mNG::3xFlag::ccdc-47]) III.
Notes: Made_by: Anita Rhodes (Glow Worms '20)|"N-terminal tag of CCDC-47 via CRISPR/Cas9 knock-in of mNeonGreen at ccdc-47 locus. Insertion verified by PCR, Sanger sequencing, and fluorescence. Left flank: 5' gttaaatcactcaatttcgggtcgttcacc 3'; Right flank: 5' ATGAAGATAGTATGGATTTTCCTAATATTC 3' (3 silent mutations); sgRNA: cgttcaccATGAAAATCGTC; Cas9/sgRNA plasmid: pGLOW13; mNG^SEC^3xFlag plasmid: pGLOW17; SEC insertion allele strain (balanced): GLW38."

Proper citation: RRID:WB-STRAIN:WBStrain00051690 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051694

Source Database: WormBase (WB)
Affected Genes: WBGene00002008(hsp-4)
Genomic Alteration: WBGene00002008(hsp-4)
Availability: unknown
Source References: EMPTY
Synonyms: hsp-4(utx39[hsp-4::mNG::3xFlag]) II.
Notes: C-terminal tag of HSP-4 via CRISPR/Cas9 knock-in of mNeonGreen at hsp-4 locus. Insertion verified by PCR and fluorescence. Left flank: 5' TCGGCCGGAGGACAAGGAGAACAAGCTTCTGAGGAGCCATCGGAGGATCATGATGAACTG 3' (1 silent mutation); Right flank: 5' TAAaatattaattgccttcaactacttgct 3'; sgRNA: CGTCTCCAAACTTTACTCGG; Cas9/sgRNA plasmid: pGLOW44; mNG^SEC^3xFlag plasmid: pGLOW61; SEC insertion allele strain: GLW46.|"Made_by: Quincy Martin (Glow Worms '21)"

Proper citation: RRID:WB-STRAIN:WBStrain00051694 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051693

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: ZK1058.9(utx37[ZK1058.9::mNG::3xFlag]) III
Notes: C-terminal tag of ZK1058.9 via CRISPR/Cas9 knock-in of mNeonGreen at ZK1058.9 locus. Insertion verified by PCR and fluorescence. Left flank: 5' AGCTCAACGGCTAGCTGGTCTCGTTATTAT 3' (1 silent mutation); Right flank: 5' TAAtgaattttcctccaacttttgtcctct 3'; sgRNA: AATAACGAGACCAGCTAG (18 bp); Cas9/sgRNA plasmid: pGLOW58; mNG^SEC^3xFlag plasmid: pGLOW68; SEC insertion allele strain: GLW44.|"Made_by: Dan Tatulescu (Glow Worms '21)"

Proper citation: RRID:WB-STRAIN:WBStrain00051693 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051692

Source Database: WormBase (WB)
Affected Genes: WBGene00011036(edc-3)
Genomic Alteration: WBGene00011036(edc-3)
Availability: unknown
Source References: EMPTY
Synonyms: edc-3(utx35[mNG::3xFlag::edc-3]) I.
Notes: Made_by: Diya Sharma (Glow Worms '21)|"N-terminal tag of EDC-3 via CRISPR/Cas9 knock-in of mNeonGreen at edc-3 locus. Insertion verified by PCR and fluorescence. Left flank: 5' ggttccaattcttctgatttcaaattaaaa 3'; Right flank: 5' ATGGATGACAAACTCATTGGAAGCGTCATCTCTACGGAGACAAAGGACGG 3' (7 silent mutations); sgRNA: ATATCAACCGAAACTAAAGA; Cas9/sgRNA plasmid: pGLOW81; mNG^SEC^3xFlag plasmid: pGLOW103; SEC insertion allele strain: GLW42."

Proper citation: RRID:WB-STRAIN:WBStrain00051692 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051691

Source Database: WormBase (WB)
Affected Genes: WBGene00003607(nhr-8)
Genomic Alteration: WBGene00003607(nhr-8)
Availability: unknown
Source References: EMPTY
Synonyms: nhr-8(utx33[mNG::3xFlag::nhr-8]) IV.
Notes: Made_by: Gillian Witten (Glow Worms '21)|"N-terminal tag of NHR-8 via CRISPR/Cas9 knock-in of mNeonGreen at nhr-8 locus. Insertion verified by PCR and Sanger sequencing. Left flank: 5' taatcactaaaacaaaaatttcgtcattcc 3'; Right flank: 5' ATGCCTTCGTCTTCTCCATCGATGGACGAG 3'; sgRNA: CGATGGAGAAGACGAAGGCA; Cas9/sgRNA plasmid: pGLOW55; mNG^SEC^3xFlag plasmid: pGLOW56; SEC insertion allele strain: GLW40."

Proper citation: RRID:WB-STRAIN:WBStrain00051691 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051698

Source Database: WormBase (WB)
Affected Genes: WBGene00004931(sod-2)
Genomic Alteration: WBGene00004931(sod-2)
Availability: unknown
Source References: EMPTY
Synonyms: sod-2(utx53[mScarlet::3xMyc::sod-2]) I.
Notes: Made_by: Param Kapoor (Glow Worms '21)|"N-terminal tag of SOD-2 via CRISPR/Cas9 knock-in of mScarlet at sod-2 locus. Insertion verified by PCR and fluorescence. Left flank: 5' attgaatattttaattatttgcagccgaaa 3'; Right flank: 5' ATGCTTCAAAACACGGTTCGCTGTGTCTCA 3 (1 silent mutation); sgRNA: AAGCTTTGAGACACAGCGAA; Cas9/sgRNA plasmid: pGLOW98; mScarlet^SEC^3xMyc plasmid: pGLOW111; SEC insertion allele strain: GLW64."

Proper citation: RRID:WB-STRAIN:WBStrain00051698 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051697

Source Database: WormBase (WB)
Affected Genes: WBGene00004143(pqn-59)
Genomic Alteration: WBGene00004143(pqn-59)
Availability: unknown
Source References: EMPTY
Synonyms: pqn-59(utx51[mNG::3xFlag::pqn-59]) I.
Notes: Made_by: Persephone Alicea (Glow Worms '20)|"N-terminal tag of PQN-59 via CRISPR/Cas9 knock-in of mNeonGreen at pqn-59 locus. Insertion verified by PCR and fluorescence. Left flank: 5' gaccctttttatttataatttgttttcaga 3'; Right flank: 5' ATGGGTATTAAAGGCGACAAAAAAGCTACT 3 (1 silent mutation); sgRNA: TGCAAGTCGCGCTTGATCGC; Cas9/sgRNA plasmid: pGLOW23; mNG^SEC^3xFlag plasmid: pGLOW24; SEC insertion allele strain (balanced): GLW62."

Proper citation: RRID:WB-STRAIN:WBStrain00051697 Copy   

•   Source: Integrated Animals