Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Database:WB (facet)

Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

64,152 Results - per page

Show More Columns | Download Top 1000 Results

Organism Name Proper Citation Species Synonyms Notes Phenotype Affected Gene Genomic Alteration Catalog Number Background Database Database Abbreviation Availability Source References Alternate IDs Record Last Update Mentions Count
W01A11.1(ve935[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00063035 Caenorhabditis elegans W01A11.1(ve935[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Homozygous viable. Deletion of 2962 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGCCCGTTGCAATCGGGGTTCTCGCCGCCG ; Right flanking sequence: AGGTCTCCCGTCATTCCTATAACATCACCC. W01A11.1 sgRNA A: CGGCAACAAATTCCATACGG; W01A11.1 sgRNA B: CTATGACCGTACACCAATCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) WB-STRAIN:WBStrain00063035 WormBase (WB) WB unknown 2026-09-05 04:59:49 0
nep-11(ve833[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00062981 Caenorhabditis elegans nep-11(ve833[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Homozygous viable. Deletion of 2722 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AATATCTTCGAATCTCTCATCCAAGTACCT ; Right flanking sequence: TTTCACTGATAGTTATCAGTTGCATCTGAC. sgRNA #1: GAGTTGTCCAGTCAAACGTG; sgRNA #2: ATAGTGATATACCTACTCCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00017557(nep-11) WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00017557(nep-11) WB-STRAIN:WBStrain00062981 WormBase (WB) WB unknown 2026-09-05 04:59:48 0
gln-5(ve937[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00063037 Caenorhabditis elegans gln-5(ve937[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Homozygous viable. Deletion of 1358 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GCCAATTGAAAGCTAAAAATTCAGAAAGAT ; Right flanking sequence: TTGACCGAGAGGAAGACGAGTTTCGTAGTT. gln-5 sgRNA A: CATGCGTTAGTTTATTCGGG; gln-5 sgRNA B: GCCACCATCGATCATTTCAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" WBGene00001606(gln-5)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) WBGene00001606(gln-5), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) WB-STRAIN:WBStrain00063037 WormBase (WB) WB unknown 2026-09-05 04:59:49 0
Y38C1AA.6(ve881[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00062987 Caenorhabditis elegans Y38C1AA.6(ve881[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Homozygous viable. Deletion of 851 with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GTGAACAATGTTTCGATCAAAAACATTCCC ; Right flanking sequence: CGGTGTTGGAGTGTTTCAATGAAGATGATG. Y38C1AA.6 sgRNA #1: GTTGCAAATTGGGCATGAAG; Y38C1AA.6 sgRNA #2: AGATTTCCAACTTATTGACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) WB-STRAIN:WBStrain00062987 WormBase (WB) WB unknown 2026-09-05 04:59:48 0
clec-86(ve922[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00063023 Caenorhabditis elegans clec-86(ve922[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Homozygous viable. Deletion of 512 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: cttgtcgcgcttttgtgttttgtgtCACCA ; Right flanking sequence: CCCACCATGTCCATCTTGTTCTAAATAACT. clec-86 sgRNA A: GTATCTCCAGGAAGACAATT; clec-86 sgRNA B: CATGTGTACGATCCTCCAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00016912(clec-86) WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00016912(clec-86) WB-STRAIN:WBStrain00063023 WormBase (WB) WB unknown 2026-09-05 04:59:49 0
gsto-1(ve926[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00063027 Caenorhabditis elegans gsto-1(ve926[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Homozygous viable. Deletion of 1355 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CGACTGGTTTTAATATCAAAGGCCCAAATC ; Right flanking sequence: AGGTTCCGCATCTCCTTTTCGAATTGCTTT. gsto-1 sgRNA A: ATAATTCAATTCCTGGTGCG; gsto-1 sgRNA B: AAAGATCCCTTTGATAGCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00016204(gsto-1) WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00016204(gsto-1) WB-STRAIN:WBStrain00063027 WormBase (WB) WB unknown 2026-09-05 04:59:49 0
Caenorhabditis sp. 74 wild isolate.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00062973 Caenorhabditis sp. 74 Caenorhabditis sp. 74 wild isolate. Male/Female, maintain by mating. Isofemale line isolated from rotting breadfruit flowers in Kitti, Pohnpei, Micronesia (N 6.8632, E 158.1765), December 2023. Gonochoristic species in the Japonica Group. Reference: Rockman M, et al. 2024. New species from Pohnpei, Micronesia. In preparation. WB-STRAIN:WBStrain00062973 WormBase (WB) WB unknown 2026-09-05 04:59:48 0
cuc-1(syb1006) III.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00062971 Caenorhabditis elegans cuc-1(syb1006) III. cuc-1 null mutant. Grows well on standard media but has a slightly reduced brood size and ~10% of gonad arms show a migration defect. Reference: Zhang X, et al. Biometals. 2020 Jun;33(2-3):147-157. doi: 10.1007/s10534-020-00239-z. PMID: 32506305.|"Made_by: Xiaolu Zhang" WBGene00000835(cuc-1) WBGene00000835(cuc-1) WB-STRAIN:WBStrain00062971 WormBase (WB) WB unknown 2026-09-05 04:59:48 0
Caenorhabditis sp. 75 wild isolate.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00062976 Caenorhabditis sp. 75 Caenorhabditis sp. 75 wild isolate. Male/Female, maintain by mating. Isofemale line isolated from rotting kotop (Clinostigma ponapensis) fruit in Kitti, Pohnpei, Micronesia (N 6.8577, E 158.2156), December 2023. Gonochoristic species in the Japonica Group. Reference: Rockman M, et al. 2024. New species from Pohnpei, Micronesia. In preparation. WB-STRAIN:WBStrain00062976 WormBase (WB) WB unknown 2026-09-05 04:59:48 0
hIn1 [umnIs78 unc-54(h1040)]/+ I.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00062977 Caenorhabditis elegans hIn1 [umnIs78 unc-54(h1040)]/+ I. Made_by: Yvan Doctorovich|"umnIs78 [myo-2p::mKate2 + NeoR, I: 12541645 (intergenic)] I. Heterozygous strain. Crossover suppressor for LGI right. Inversion includes unc-75 and unc-54(h1040). Heterozygotes are wild-type (not paralyzed) with dim mKate2 expression in pharynx, and segregate heterozygotes (not paralyzed, dim mKate2), homozygous wild-type (not paralyzed, no mKate2), and hIn1 homozygotes (paralyzed, bright mKate2). Pick non-paralyzed, dim mKate2 worms and check for correct segregation of progeny to maintain. Maintain at 20C or higher: recombined balancer seems more prone to breaking down at low temperatures. Derived by crossing parental strain CGC105 (hIn1[umnIs78]) to RG3173 (Y40B1B.7(ve673[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hIn1[unc-54(h1040)]) and selecting for the recombined hIn1 worms." WBGene00006789(unc-54) WBGene00006789(unc-54) WB-STRAIN:WBStrain00062977 WormBase (WB) WB unknown 2026-09-05 04:59:48 0
Caenorhabditis sp. 72 wild isolate.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00062974 Caenorhabditis sp. 72 Caenorhabditis sp. 72 wild isolate. Male/Female, maintain by mating. Isofemale line isolated from rotting Citrus aurantifolia in Kitti, Pohnpei, Micronesia (N 6.8652, E 158.173), December 2023. Gonochoristic species in the Japonica Group. Reference: Rockman M, et al. 2024. New species from Pohnpei, Micronesia. In preparation. WB-STRAIN:WBStrain00062974 WormBase (WB) WB unknown 2026-09-05 04:59:48 0
cal-1(ve928[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00063029 Caenorhabditis elegans cal-1(ve928[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Homozygous viable. Deletion of 1987 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTTTACGAACTCTTCGTAATCAATTTCCCC ; Right flanking sequence: CGGTTTGCTTACCATATCTCTGGCGAGTCG. cal-1 sgRNA A: AAGTTGATGTGGATGGAGAC; cal-1 sgRNA B: TTCATGCTCCATGTTAGTCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" WBGene00000285(cal-1)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) WBGene00000285(cal-1), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) WB-STRAIN:WBStrain00063029 WormBase (WB) WB unknown 2026-09-05 04:59:49 0
cutl-18(syb8442[mNG::cutl-18]) V.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00062967 Caenorhabditis elegans cutl-18(syb8442[mNG::cutl-18]) V. Made_by: SUNY Biotech|"mNeonGreen tag inserted into endogenous cutl-18 locus using CRISPR/Cas9. mNeonGreen tag inserted just after endogenous signal sequence. Reference: Schmidt HF, et al. 2025 Jan:517:265-277. doi: 10.1016/j.ydbio.2024.10.008. PMID: 39489317." WBGene00009830(cutl-18) WBGene00009830(cutl-18) WB-STRAIN:WBStrain00062967 WormBase (WB) WB unknown 2026-09-05 04:59:48 0
tsp-20(ve909[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00063011 Caenorhabditis elegans tsp-20(ve909[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Homozygous viable. Deletion of 1448 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGTTGGGGCTATCACTCAAAGCACAGCCCT ; Right flanking sequence: AGGTATGAAATGAACAATTGACATTTTGAA. tsp-20 sgRNA A: CAAGAGTACACATCAACGGA; tsp-20 sgRNA B: AAACTATACTTACCACAAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006646(tsp-20)|WBGene00006789(unc-54) WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006646(tsp-20), WBGene00006789(unc-54) WB-STRAIN:WBStrain00063011 WormBase (WB) WB unknown 2026-09-05 04:59:48 0
taf-8(ve915[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mIn1 [dpy-10(e128) umnIs43] II.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00063016 Caenorhabditis elegans taf-8(ve915[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mIn1 [dpy-10(e128) umnIs43] II. Made_by: RG KO Group|"umnIs43 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous larval arrest. Deletion of 1934 with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve915 homozygotes), and Dpy non-GFP mKate2+ (mIn1 homozygotes). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny.Left flanking Sequence: GAATGCTTCCTCAACACAATACATTTATTA ; Right flanking sequence: ACGACTACGGCAATTATGAGGATGAAGAGA. taf-8 sgRNA A: GGAGACCGACTATTGCAGGA; taf-8 sgRNA B: TGTCGCGTATCGGAGGGCAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation." WBGene00001072(dpy-10)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006390(taf-8)|WBGene00006789(unc-54) WBGene00001072(dpy-10), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006390(taf-8), WBGene00006789(unc-54) WB-STRAIN:WBStrain00063016 WormBase (WB) WB unknown 2026-09-05 04:59:48 0
hlh-15(syb7688 [hlh-15::GFP]) X.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00062962 Caenorhabditis elegans hlh-15(syb7688 [hlh-15::GFP]) X. Endogenous locus tagged with GFP at C-terminus using CRISPR/Cas9. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329|"Made_by: SunyBiotech" WBGene00001959(hlh-15) WBGene00001959(hlh-15) WB-STRAIN:WBStrain00062962 WormBase (WB) WB unknown 2026-09-05 04:59:48 0
ZC190.4(ve913[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00063014 Caenorhabditis elegans ZC190.4(ve913[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Homozygous viable. Deletion of with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence:AAAAAGTTGCGACTCCATAAATATGCTCCT ; Right flanking sequence:TTTCAATTTACAAAAATAGGTTAGCCATGT. ZC190.4 sgRNA #1:TATGTCATGTCTTGGAAGAG ZC190.4 sgRNA #2:GATGGGGTTATTACACAACT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) WB-STRAIN:WBStrain00063014 WormBase (WB) WB unknown 2026-09-05 04:59:48 0
col-93::mNG(syb7695) III.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00062963 Caenorhabditis elegans col-93::mNG(syb7695) III. Made_by: SunyBiotech|"mNG inserted at C-terminus of endogenous col-93 locus." WBGene00000668(col-93) WBGene00000668(col-93) WB-STRAIN:WBStrain00062963 WormBase (WB) WB unknown 2026-09-05 04:59:48 0
Y38C1AA.19(ve917[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00063018 Caenorhabditis elegans Y38C1AA.19(ve917[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Homozygous viable. Deletion of 1665 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTCCTAAGTTATTTTCTTATCGGACTCCT ; Right flanking sequence: tttcggctgttttccggctggcagcgAGTT. Y38C1AA.19 sgRNA A: CATTTTATTGACGACTGATA; Y38C1AA.19 sgRNA B: aactatacgttgtcggctgg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) WB-STRAIN:WBStrain00063018 WormBase (WB) WB unknown 2026-09-05 04:59:48 0
col-71::mNG(syb8144) II.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00062964 Caenorhabditis elegans col-71::mNG(syb8144) II. Made_by: SunyBiotech|"mNG inserted at C-terminus of endogenous col-71 locus." WBGene00000647(col-71) WBGene00000647(col-71) WB-STRAIN:WBStrain00062964 WormBase (WB) WB unknown 2026-09-05 04:59:48 0

Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.