Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
SD-Eml1tish/Scrb Resource Report Resource Website |
RRID:RGD_597538479 | Rattus norvegicus | The first tish animals were identified on the basis of postmortem histological analyses during the course of unrelated experiments using a strain of Sprague Dawley rats maintained at the University of Virginia. It is called tish (telencephalic internal structural heterotopia) rat. The brain of this mutant animal exhibits a large region of heterotopic gray matter that is located bilaterally beneath the neocortex. Mild to moderate ventriculomegaly is also observed in most tish animals. A breeding colony was established by identifying living relatives of deceased tish individuals, and then these relatives were screened using magnetic resonance imaging (MRI). The tish is identified recessive to wild type by breeding. The mutation was identified as a 1215 bp deletion in the unannotated exon 1 of Eml1 genome (Rnor_6.0; ENSRNOG00000043143). University of Virginia, Charlottesville, VA, United States | 597538479 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 597538479 | 2026-09-05 06:52:46 | 0 | |||||
|
SD-Il6em1Yona-/- Resource Report Resource Website |
RRID:RGD_407450413 | Rattus norvegicus | The Il6 knockout (KO) rats were generated using the CRISPR/Cas9 technique to induce a shift in the reading frame of the second exon of Il6 by KAC Co. Ltd (Kyoto, Japan). This strain carried a 118 bp deleted in the second exon of IL-6 National Cerebral and Cardiovascular Center Research Institute, Suita, Osaka 564-8565, Japan | 407450413 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 407450413 | 2026-09-05 06:52:46 | 0 | |||||
|
WIC;W-Oprk1em1(cre)Nurep Resource Report Resource Website |
RRID:RGD_598154602 | Rattus norvegicus | Oprk1-cre rats were generated by Dr. Hiroko Tsukamura, Dr. Yoshihisa Uenoyama, Dr. Naoko Inoue, Dr. Mayuko Nagae (Nagoya University) and Dr. Masumi Hirabayashi (National Institute for Physiological Sciences). The CRISPR/Cas9 and adeno-associated virus vector (Oprk1 [exon 4], T2A, Cre) were introduced into the pronuclear stage embryos of Wistar rats (Crlj:WI). It was maintained by mating with the Wistar-Imamichi rats (Iar:WIC) (RGD:125097496) or by sibling mating. National BioResource Project for the Rat in Japan | 598154602 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2025-04-30) | 598154602 | 2026-09-05 06:52:47 | 0 | |||||
|
ZFDM-Lcn2em1Nyo Resource Report Resource Website |
RRID:RGD_598154604 | Rattus norvegicus | "This knock-in rat was generated by injecting guide RNA, Cas9 protein, and ssODN targeting the Lcn2 gene into fertilized eggs of ZFDM rats. The Lcn2 gene of ZFDM rats has a nonsense mutation (c.409C>T, p.Gln137X), but in this line, this mutation is replaced with the wild type sequence by homologous recombination with the introduced ssODN. The target sequence of the guide RNA is TGACTACGACTAGTTTGCCA. The ssODN sequence for inducing homologous recombination is AAGTGGCCGACACTGACTACGACCAGTTTGCCATGGTATTTTTCCAGAAGACCTCTGAAA. " National BioResource Project for the Rat in Japan | 598154604 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2025-04-30) | 598154604 | 2026-09-05 06:52:47 | 0 | |||||
|
SD-Crhtm1(Cre)Kji Resource Report Resource Website 1+ mentions |
RRID:RGD_401976372 | Rattus norvegicus | CRISPR/Cas9 technology was used to insert an IRES for Cre expression after the corticotropin-releasing hormone (Crh) gene and is expressed in cells that produce CRH. | 401976372 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 401976372 | 2026-09-05 06:52:46 | 1 | |||||
|
SD-Prnpem1Evm Resource Report Resource Website |
RRID:RGD_630350554 | Rattus norvegicus | A deletion mutation was induced using CRISPR/Cas9 system in embryos of Spague-Dawley rats from Charles River. This strain has been deposited with the RRRC | 630350554 | mutant | Rat Genome Database (RGD) | RGD | Live Animals (as of 2026-01-15) | 630350554 | 2026-09-05 06:52:47 | 0 | |||||
|
SD-Per1em1Smoc Resource Report Resource Website |
RRID:RGD_629006641 | Rattus norvegicus | CRISPR/Cas9 system was used to generate rats with a deletion of the CRE site (Del_TGACGTCA) in the Per1 gene promoter Per1 gene in Sprague Dawley (Charles River) rat embryos. National Institute on Drug Dependence and Beijing Key Laboratory on Drug Dependence Research, Peking University, Beijing, China | 629006641 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 629006641 | 2026-09-05 06:52:47 | 0 | |||||
|
LH-C17h6orf52em2Aek Resource Report Resource Website |
RRID:RGD_630350551 | Rattus norvegicus | The CRISPR/Cas9 system was used to delete the entire C17h6orf52 gene from LH/MavRrrcAek embryos. Deletion ranges on chromosome 17 from 23968511 to 23982103 in GRCr8 per NCBI blast - see attachment for sequence annotation. Currently live colony with Dr. Anne Kwitek at the Medical College of Wisconsin. Being cryopreserved and the live colony will not be available. | 630350551 | mutant | Rat Genome Database (RGD) | RGD | Live Animals (as of 2026-01-14) | 630350551 | 2026-09-05 06:52:47 | 0 | |||||
|
SD-Dmdem1Ins Resource Report Resource Website |
RRID:RGD_630350396 | Rattus norvegicus | Deletion of exons 45 to 47 of the rat Dmd gene by CRISPR/Cas9 was performed by using two pairs of sgRNAs on both sides of exons 45 and 47. The spCas9 and sgRNAs were electroporated in rat Sprague Dawley (RjHan:SD) fertilized oocytes. Genotyping PCR and sequencing were used to confirm the deletion of exons 45–47 in F0 founder animals. Rats can be obtained through material transfer agreement by contacting the corresponding author at valentina.- [email protected] and [email protected]. | 630350396 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 630350396 | 2026-09-05 06:52:47 | 0 | |||||
|
SD-Tlr4em6Mcwi Resource Report Resource Website |
RRID:RGD_404976869 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the Tlr4 gene of Crl:SD rat embryos. The resulting mutation is a 14-bp deletion in exon 2; rn7:chr5:80,151,447-80,151,460. Contact MCW rat distribution at [email protected] | 404976869 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2024-03-18) | 404976869 | 2026-09-05 06:52:47 | 0 | |||||
|
SS-Shc1em6Mcwi Resource Report Resource Website |
RRID:RGD_124715482 | Rattus norvegicus | Generated by pronuclear injection of a CRISPR plasmid expressing Cas9 and single-guide RNA targeting the sequence CACTCAGCTTGTTCATGTCCTGG (protospacer adjacent motif underlined) into one-cell SS (SS/JrHsdMcwi) rat embryos. This model harbors a 6-bp deletion (mRatBN7.2 chr2:174,841,367-174,841,372) including the p52SHC initiation codon. Contact MCW rat distribution at [email protected] | 124715482 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 124715482 | 2026-09-05 06:52:48 | 0 | |||||
|
SD-Dbhem1(cre)Xyan Resource Report Resource Website |
RRID:RGD_632518356 | Rattus norvegicus | DBH-Cre knock-in (KI) rats, developed on the Sprague Dawley (SD) rat background, were generated using the CRISPR/Cas9 system. In this knock-in model, a gene cassette encod- ing 2A peptide, fused to Cre recombinase was introduced to replace the TAA stop codon in exon 12 of the rat Dbh gene. Additionally, a synonymous mutation p. T616= (ACG to ACA) was incorporated to pre- vent gRNA binding and recutting of the sequence following homology-directed repair. The gRNA targeting the rat DBH gene (gRNA-B1: 5′-TTACTCAGTGTCTGCCTCCGTGG-3′), the donor vector con- taining the “P2A-Cre” cassette, and a synonymous mutation p. T616= (ACG to ACA), along with Cas9 mRNA, were co-injected into fertilized rat embryos. F0 founders. DBH-Cre KI rats were bred with wild-type SD rats (Guangdong Vital River Laboratory Animal Technology Co., Ltd., China). Shenzhen Institute of Advanced Technolog, Shenzhen, China | 632518356 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 632518356 | 2026-09-05 06:52:47 | 0 | |||||
|
WAG-Cd247em9Mcwi Resource Report Resource Website |
RRID:RGD_152985692 | Rattus norvegicus | CRISPR/Cas9 mutagenesis was used to knockout Cd247 in the WAG/RijCmcr (WAG) strain. A single guide RNA (sgRNA) targeting the Cd247 exon 2 sequence GATGGAATCCTCTTCATCTACGG (protospacer adjacent motif in bold) was injected along with SpCas9 protein into one-cell WAG embryos. A founder offspring harboring a 17-bp frame-shift indel mutation deleting GAATCCTCTTCATCTAC (rn6.0 chr13:84,064,185-84,064,201) was identified and confirmed by Sanger sequencing. The frameshift mutation is predicted to cause a premature truncation of the normal 165 amino acid protein coding sequence after only 37 amino acids, lacking most of the transmembrane and the entirety of the external cellular protein domains. Contact MCW rat distribution at [email protected]. | 152985692 | mutant | Rat Genome Database (RGD) | RGD | Live Animals (as of 2022-06-08) | 152985692 | 2026-09-05 06:52:47 | 0 | |||||
|
SD-Shank3em1Bcgen Resource Report Resource Website |
RRID:RGD_631721277 | Rattus norvegicus | The mutant rats were generated using CRISPR/Cas9 technology to target upstream of exon 11 or downstream of exon 21 of rat Shank3. The resulting mutant carried approximately 26 kb deletions with the removal of the Shank3 exon 11–21 [email protected] at Department of Neurobiology, School of Basic Medical Sciences, Peking University, Beijing, China | 631721277 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 631721277 | 2026-09-05 06:52:47 | 0 | |||||
|
SD-Ager em1Mcwi Resource Report Resource Website |
RRID:RGD_152998995 | Rattus norvegicus | This model was generated at the Medical College of Wisconsin by CRISPR/Cas9 in Crl:SD strain. The resulting mutation is a 16-bp deletion in the third exon of Ager. rn6.0:chr20:4,150,397-4,150,412. contact MCW Rat Distribution at [email protected] | 152998995 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2022-07-15) | 152998995 | 2026-09-05 06:52:47 | 0 | |||||
|
CD-Dmdem1Gene+/+ Resource Report Resource Website |
RRID:RGD_629142769 | Rattus norvegicus | The is the wild type litter mate for the Dmd mutant: CD-Dmdem1Gene (RGD:629142768), Genethon; 1, bis rue de l’internationale23 91000 Evry, France | 629142769 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 629142769 | 2026-09-05 06:52:47 | 0 | |||||
|
CD-Dmdem1Gene Resource Report Resource Website |
RRID:RGD_629142768 | Rattus norvegicus | The model was generated using a single guide RNA-Cas9 targeted to exon 45 of the rat Dmd gene on a Sprague-Dawley (CD®(SD), Crl:CD(SD)) background. One male founder with a 606 bp deletion encompassing Dmd exon 45 and spanning from 207 bp into the 3’ region of intron 44 to 223 bp into the 5’ region of intron 45,including exon 45, was selected for phenotyping. The heterozygous/hemizygous Dmd knock-out lines were used for breeding. Genethon; 1, bis rue de l’internationale23 91000 Evry, France | 629142768 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 629142768 | 2026-09-05 06:52:47 | 0 | |||||
|
SD-Slc5a9em1Mcwi Resource Report Resource Website |
RRID:RGD_617301241 | Rattus norvegicus | Crl:SD embryos were injected with CRISPR-Cas9 using guide RNA targeting the sequence AGGTCATGGATCTTCCAGCC. A 4-bp deletion in exon 2 (rn7: chr5:126,730,986-126,730,989) resulted. Dr. Noreen Rossi, Contact Email: [email protected] | 617301241 | mutant | Rat Genome Database (RGD) | RGD | Live Animals (as of 2025-07-28) | 617301241 | 2026-09-05 06:52:47 | 0 | |||||
|
SD-CdCSem1Bcgen+/- Resource Report Resource Website |
RRID:RGD_616390066 | Rattus norvegicus | To generate the 5p15.2 deletion in the rat, two CRISPR gRNAs were designed at syntenic loci in the rat genome: ATGTCGATGTCTTGTTAGGGTGG at Chr.2:83120000 (RGSC 6.0/rn6) and GCTGAGATGGCTTTCAGAAATGG at Chr.2:84800000 (RGSC 6.0/rn6), which induced ≈1.68 Mb chromosomal deletion. The Biocytogen Transgenic and Gene Targeting core injected 50 ng uL−1 of each gRNAs and 100 ng uL−1 Cas9 RNA into single‐cell SD rat zygotes. Embryos were cultured overnight and transferred to pseudopregnant females. PCR was used to screen for the deletion. PCR was performed using genomic ear or tail DNA, and the following primer pair: Proximal Forward‐TTGCTCAGCTGTTAAGGGAAACTAT and Distal Reverse‐TCATCAAAATGCACCAAAAGTGCAA (these primers generate ≈485 bp product). PCR primers were used to detect the breakpoint on the undeleted 5p15.2 interval (wild‐type allele): Proximal Forward‐TTGCTCAGCTGTTAAGGGAAACTAT and Proximal Reverse‐GGAGTAAGTCAACTGACTAGGGGACA (these primers generate ≈618 bp product). | 616390066 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 616390066 | 2026-09-05 06:52:47 | 0 | |||||
|
SD-Slc5a10em1Mcwi Resource Report Resource Website |
RRID:RGD_617301243 | Rattus norvegicus | Crl:SD embryos were injected with CRISPR-Cas9 using guide RNA targeting the sequence GAATACATTCAGAAGCGCTT. A 29-bp deletion in exon 5 (rn7: chr10:46,393,272-46,393,300) resulted. Dr. Noreen Rossi, Contact Email: [email protected] | 617301243 | mutant | Rat Genome Database (RGD) | RGD | Live Animals (as of 2025-07-28) | 617301243 | 2026-09-05 06:52:47 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
