Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=598154597
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2025-04-30)
Alternate IDs: 598154597
Notes: The CRISPR/Cas9 genome editing system targeting exon 2 of rat Mkx gene was injected to the Wistar embryo to generate this knock out rat strain with 7- bp deletion causing frameshift mutation in the gene. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_598154597 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=598092586
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2025-03-27)
Alternate IDs: 598092586
Notes: The ES cell line derived from Lister Hooded rats (Seac:LIS), which was established by Prof. Sakimura at Department of Animal Model Development, Brain Research Institute, Niigata University, was used. Cloned ES cells established by introducing a vector of RCaMP2-flox stop at the Rosa26 locus were injected into fertilized eggs of SD rats (Slc:SD) using a microinjection method. RCaMP2 stands for red calcium indicator (PMID: 25419959). National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_598092586 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=598154599
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals (as of 2025-04-30)
Alternate IDs: 598154599
Notes: This strain was generated at the Institute of Medical Science, University of Tokyo, by using CRISPR-Cas3. Microinjected into pronuclear-stage rat embryos of the F344/Jcl strain. The embryos were transferred into the oviducts of pseudopregnant females. A strain with a 1,869 bp deletion in the Il2rg gene was established from the resulting litters. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_598154599 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=598092510
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals; Cryopreserved Sperm (as of 2025-03-21)
Alternate IDs: 598092510
Notes: we used CRISPR-Cas9 technology to generate a PBK KO rat. Cas9 editing of exon 4 in the rat PBK gene resulted in the insertion of a single “T” resulting in a frame shift and premature termination of the PBK protein. PMCID: PMC11650665 Availability Contact Email: [email protected] at Augusta University
Proper citation: RRID:RGD_598092510 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=408364982
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals (as of 2024-11-08)
Alternate IDs: 408364982
Notes: The C1ql3 knout rats were established using CRISPR/cas9 method. The exon 1 of C1ql3 was
targeted with two sgRNAs of (TCATC CTC ATC CCG GTG CTGG) and
(AAGGT GCT GAC AAG AGG GAGG), which, respectively, targeted on
the 5′ end and the 3′ end of exon 1.Wistar embryos born from Sprague Dawley pseudo-pregnant female were genotyped by polymerase chain reaction (PCR) with two
upstream primers of (5′-TCCAAAAG CAG ACA AGA GGATC-3′
and 5′-CTACTTCT TCA CCT ACC ACG TCCTG-3′)
and one downstream primer
(5′-GGCTTCTG AAA CCT TAT ACA TTCTCG-3′). This mutant carried a 631-bp deletion resulting a premature stop at 61 bp of the open reading frame. National Human Disease Animal Model Resource Center, Beijing, China (https://namr.org.cn/Ldesc/1_1074)
Proper citation: RRID:RGD_408364982 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=616336066
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Extinct (as of 2025-05-14)
Alternate IDs: 616336066
Notes: F344/Jcl rat fertilized eggs were microinjected and then transplanted into the oviducts of pseudopregnant females. From the resulting offspring, rats with the Alb promoter-Cre sequence inserted into the ROSA26 gene were selected and established. The Alb promoter-Cre sequence is inserted in an inverted position. Cre is expressed specifically in the liver. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_616336066 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=616336067
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2025-05-14)
Alternate IDs: 616336067
Notes: Fertilized eggs from F344/Jcl rats were microinjected and then transplanted into the oviducts of pseudopregnant females. From the resulting offspring, rats with the 2A-Cre sequence inserted into the Albumin gene were selected and established. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_616336067 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=616336065
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2025-05-14)
Alternate IDs: 616336065
Notes: F344/Jcl rat fertilized eggs were microinjected and then transplanted into the oviducts of pseudopregnant females. From the resulting offspring, rats with the Alb promoter-Cre sequence inserted into the Rosa26 gene were selected and established. Although the Alb promoter is inserted, cre leakage is confirmed throughout the body. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_616336065 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=598092591
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2025-03-27)
Alternate IDs: 598092591
Notes: The T2A, nlsCre, and BGHpolyA are knocked in at the stop codon in the 13th exon of the tyrosine hydroxylase (TH) gene (NCBI Gene ID: 25085). National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_598092591 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=616336063
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 616336063
Notes: This rat strain with neuronal specific knock out of Mt-co3 was generated by crossing a rat neuron-specific Cre strain (NeuN-Cre) with SD-ROSA26 em1(CAG-loxP-stop-loxP-DdCBE-Mt-co3/Ilas. Compared with the controls, the neuron-specific Mt-co3 knock out rats were largely normal in the first postnatal month, but progressively developed ALS-like symptoms afterward. Rat Resource Center of China (www.ratresource.com)
Proper citation: RRID:RGD_616336063 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=598092592
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2025-03-27)
Alternate IDs: 598092592
Notes: The T2A, nlsCre, and BGHpolyA are knocked in at the stop codon in the 13th exon of the tyrosine hydroxylase (TH) gene (NCBI Gene ID: 25085). National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_598092592 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=598092593
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2025-03-28)
Alternate IDs: 598092593
Notes: Deletion of exon1 of Gpr143 gene in Wistar rats (Charles River, Japan) by CRISPR/Cas9. Line No. is 19. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_598092593 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=616335894
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 616335894
Notes: The knock in of "CAG-loxP-stop-loxP-DdCBE-Mt-co3" to ROSA26 was induced by CRISPR/Cas9 in SD embryos from Vital River. This ROSA 26 knock in construct carrying DddA-derived cytosine base editor (DdCBE)linked to Mt-co3 was used to introduce premature stop codons in the rat Mt-co3 in mitochondrial genome in the presence of Cre recombinase. Rat Resource Center of China (www.ratresource.com)
Proper citation: RRID:RGD_616335894 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=598092525
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2025-03-25)
Alternate IDs: 598092525
Notes: This strain was established by CRISPR/Cas9 system in the Research Institute, National Cerebral and Cardiovascular Center. Genetic background is Slc:SD. guide RNA gRNA No1; ATAAGTAACGACAGCAGTGA gRNA No2; GAGTTTCACTCGGTCCACGA National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_598092525 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=598092524
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Embryo (as of 2025-03-25)
Alternate IDs: 598092524
Notes: In 1987, a Ws mutant (RGD:12910762) with a light-colored coat and large abdominal white spots was discovered in a colony of BN/fMai inbred rats that had been allocated to Yagi Memorial Park from the Institute of Laboratory Animals Graduate School of Medicine, Kyoto University. However, homozygous for the Ws mutation could not be obtained in BN inbred rats due to embryonic lethality. Therefore, they crossed with Donryu outbred rats and obtained homozygous by crossing F1 heterozygous. This strain was designated as WsRC and was supplied to Japan SLC, Inc. in 1993. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_598092524 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=407446371
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Embryo; Cryopreserved Sperm (as of 2024-08-29)
Alternate IDs: 407446371
Notes: A ~58.0 kb deletion of the rat Cyp2d gene cluster (1-5) was created using the CRISPR-Cas9 system. Subsequently, the human CYP2D6 gene (~6.2 kb) was inserted in place of the rat Cyp2d gene cluster. The rat strain is deposited to Rat Research and Resource Contact [email protected] for availability.
Proper citation: RRID:RGD_407446371 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=407446370
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown (as of 2024-08-29)
Alternate IDs: 407446370
Notes: A ~58.0 kb deletion of the rat Cyp2d gene cluster (1-5) was created using the CRISPR-Cas9 system. The rat strain is deposited to Rat Research and Resource Contact [email protected] for availability.
Proper citation: RRID:RGD_407446370 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=405849381
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 405849381
Notes: This Tti2 knockout rats were generated by microinjecting fertilized ova of SHR/OlaIpcv rats with the ZFN (Zinc Finger Nuclease) construct from Sigma-Aldrich. The construct was designed to target the first exon using the following sequence of ZFN binding (capital letters) and cutting site (small letters): TCTGACCCGGATCCAAGCaccaagGGTGGGTGGCAGGGC. DNA samples isolated from 452 rats born after microinjection with ZFN construct were amplified using primers flanking the target sequence: ZFN F: 5'-TACACTGTGATTGGCTGGGA-3' and ZFN R: 5'-GGCGCAGTGGAGTGATC-3'. SHR-Tti2+/- with an 8 bp deletion (NM_001013883.1(Tti2):c.243_250delCGAGATCC; on the protein level: NP_001013905.1:p.Glu82Glyfs) has been selected for further analyses. The heterozygous founder was crossed with SHR and F1 rats were intercrossed. SHR-Tti2+/- heterozygotes were selected for breeding and phenotyping while their wild type littermates were used as controls.
Proper citation: RRID:RGD_405849381 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=408364956
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Embryo (as of 2024-11-05)
Alternate IDs: 408364956
Notes: The CRISPR/Cas9 system was used to introduce deletion and insertion in exon 3 of the VDR gene of Hsd:SD rat embryos
WT: GGAGGCAACAGCGGCCAGCACCTCCCTGCccgaccCTGGTGACTTTGACCggaacgtgccccGGATCTGTGGAGTGTGTGGAGACCGAGCCAC
KO: GGAGGCAACAGCGGCCAGCACCTCCCTGCtggt– CTGGTGACTTTGACC------GGATCTGTGGAGTGTGTGGAGACCGAGCCAC Rat Resource and Research Center (RRRC); strain ID 1034
Proper citation: RRID:RGD_408364956 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=408364957
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2024-11-05)
Alternate IDs: 408364957
Notes: The F344-ApcPirc rat was generated previously by ENU mutagenesis (RGD ID 1641862). These fertilized rat embryos were used with the CRISPR/Cas9 system to introduce a 5-bp deletion (CCCCG) in exon 3 of the Vdr gene. This mutant was heterozygous for the Apc mutation and homozygous for the VDR deletion.
WT: GGAGGCAACAGCGGCCAGCACCTCCCTGCCCGACCCTGGTGACTTTGACCGGAACGTGCCCCGGATCTGTGGAGTGTGTGGAGACCGAGCCAC
KO: GGAGGCAACAGCGGCCAGCACCTCCCTGCCCGACCCTGGTGACTTTGACCGGAACGTGG ATCTGTGGAGTGTGTGGAGACCGAGCCAC Rat Resource and Research Center (RRRC); strain ID 1033
Proper citation: RRID:RGD_408364957 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
