Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
SD-Mpoem1Mcwi Resource Report Resource Website |
RRID:RGD_401717572 | Rattus norvegicus | CRISPR/SpCas9 system using sgRNA targeting the sequence CAGGGCCACGTGCAGATAGTCGG was used to introduce an 11-bp deletion (rn7: chr10:72,595,923-72,595,933) in exon 4 of the Mpo gene in Crl:SD strain rats. | 401717572 | mutant | Rat Genome Database (RGD) | RGD | Live Animals (as of 2023-08-07) | 401717572 | 2026-09-05 06:52:45 | 0 | |||||
|
CD-Ctnsem4Vjupk Resource Report Resource Website |
RRID:RGD_155630635 | Rattus norvegicus | The mutant rat was produced by injecting Crl:CD(SD) zygotes with gRNA +Cas9 ribonucleoprotein complex targeting exon 3 of rat Ctns. The founder of this strain possessed a 7-bp deletion which results in frameshift and pre-mature stop truncated protein. | 155630635 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 155630635 | 2026-09-05 06:52:45 | 0 | |||||
|
SD-Ahrem1Iexas-/- Resource Report Resource Website |
RRID:RGD_401940195 | Rattus norvegicus | The homozygous knockout rats were created using CRISPR/Cas9 gene editing to delete 10 bp of exon 2 of Ahr in Sprague Dawley rats . | 401940195 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 401940195 | 2026-09-05 06:52:45 | 0 | |||||
|
SS-Mmp2em1Mcwi+/+ Resource Report Resource Website |
RRID:RGD_5688032 | Rattus norvegicus | ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. | (null) | (null) | 5688032 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 5688032 | 2026-09-05 06:52:45 | 0 | |||
|
SD-Gcdhem1Dba Resource Report Resource Website |
RRID:RGD_10759544 | Rattus norvegicus | this strain was produced by CRISPR/Cas9 system. The resulting knock-in mutation is R411W in exon 11 of the GCDH gene. | 10759544 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 10759544 | 2026-09-05 06:52:45 | 0 | |||||
|
SD-Trim44em1Lizh Resource Report Resource Website |
RRID:RGD_329969883 | Rattus norvegicus | A pair of synthetic oligonucleotides for sgRNA (sgRNA1, CCTTGCCGCTTTAAGTGACTC; sgRNA2, CCATGTTGGGAGCATTGCCTA) were annealed and then cloned into the pUC57-sgRNA expression vector, and the floxed plasmid donor was cloned into the pGSI plasmid. Both the Cas9 and sgRNA expression plasmids were linearized and used as templates for in vitro transcription. A mixture of the donor vector (4ââ¬â¦ng/ul), Cas9 mRNA (25ââ¬â¦ng/ul), and sgRNAs (10ââ¬â¦ng/ul each) was microinjected into both the cytoplasm and male pronucleus of the fertilized eggs. The injected zygotes were then transferred to pseudopregnant SD rats, which then carried them to parturition. This is called conditional knockout Trim44 (Trim44 cKO). | 329969883 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 329969883 | 2026-09-05 06:52:45 | 0 | |||||
|
SD-Fahem3McwiIl2rgem2McwiRag1em6Mcwi Resource Report Resource Website |
RRID:RGD_401824639 | Rattus norvegicus | Produced by injection of CRISPR/Cas9 targeting the genomic sequence GGTGAGATCCTTTGAAAAGG in Rag1 into double homozygous embryos with knockout of Fah and Il2rg produced following multiple generations of intercrossing strains SD-Il2rgem2Mcwi (RGDID:10002794) and SD-Fahem3Mcw (RGDID: 10002791). The resulting CRISPR-induced mutation in Rag1 deletes 25-bp (rn7: chr3:87,923,384-87,923,408) and inserts 17 bp (ACCCTAAACAGCTGTGC) for a net 8-bp deletion. availability contact: [email protected] | 401824639 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2025-11-22) | 401824639 | 2026-09-05 06:52:45 | 0 | |||||
|
WIC;WDB-Kiss1tm1Nurep Resource Report Resource Website |
RRID:RGD_329848995 | Rattus norvegicus | The kisspeptin gene (Kiss1) is knocked out conditonally by the Cre recombinase. This strain was generated by K.I. Maeda (The University of Tokyo), H. Tsukamura, Y. Uenoyama, N. Inoue (Nagoya University), and M. Hirabayashi (National Institute for Physiological Sciences) for the purpose of producing conditional knockout rats of the Kiss1 gene in the hypothalamus. The targeting vector (loxP, Kiss1[exons 2 and 3], PGK promoter-neo, loxP) was introduced by electroporation targeting the Kiss1 gene in ES cells (WDB/Nips-ES1/Nips). Crossed with and maintained by the Wistar-Imamichi rats (Iar:Wistar-Imamichi, Institute for Animal Reproduction). National BioResource Project for the Rat in Japan | 329848995 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2023-06-07) | 329848995 | 2026-09-05 06:52:45 | 0 | |||||
|
WIC.WDB-Kiss1tm1(tdTomato)Nurep Resource Report Resource Website |
RRID:RGD_329848994 | Rattus norvegicus | Kiss1 knockout rats were generated by K.I. Maeda (The University of Tokyo), H. Tsukamura, Y. Uenoyama, N. Inoue (Nagoya University), and M. Hirabayashi (National Institute for Physiological Sciences). The targeting vector (tdTomato/puromycin N-acetyl transferase) was introduced by electroporation targeting the Kiss1 gene in ES cells (WDB/Nips-ES1/Nips). Crossed with and maintained by the Wistar-Imamichi rats (Iar:Wistar-Imamichi, Institute for Animal Reproduction). National BioResource Project for the Rat in Japan | 329848994 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2023-06-21) | 329848994 | 2026-09-05 06:52:45 | 0 | |||||
|
CD-Slc30a10em1Sommu Resource Report Resource Website |
RRID:RGD_401795484 | Rattus norvegicus | Exon 1 of Slc30a10 was targeted using CRISPR/Cas9 in the Crl:CD(SD) embryos . A mosiac founder that transmitted a 248 bp deletion in exon 1 of Slc30a10 leading to an out of frame mutation after amino acid 22 was bred to a CD rat to select for the above deletion and establish the line. The strain will be deposited to RRRC. | 401795484 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2023-09-11) | 401795484 | 2026-09-05 06:52:45 | 0 | |||||
|
SD-Esr1em1Bra+/+ Resource Report Resource Website |
RRID:RGD_405650195 | Rattus norvegicus | This is the wild type littermate from the crossing of heterozygous Esr1 mutant rats. This wild type littermate rat was used as a control for the homozygous mutant SD-Esr1em1-/- (RGD:405649860) in estrogen receptor study. Department of Medicine, Division of Pulmonary, Critical Care, Sleep and Occupational Medicine, Indiana University School of Medicine, Indianapolis, Indiana, USA. | 405650195 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 405650195 | 2026-09-05 06:52:46 | 0 | |||||
|
F344-Nox4em1Shmo Resource Report Resource Website |
RRID:RGD_598092602 | Rattus norvegicus | A one-base insertion was introduced into the first exon of the NADPH oxidase 4 (Nox4) gene of F344/DuCrj rats by CRISPR/Cas9. They were then backcrossed to F344/N (Japan SLC, Inc.). National BioResource Project for the Rat in Japan | 598092602 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2025-03-28) | 598092602 | 2026-09-05 06:52:46 | 0 | |||||
|
F344-Cybbem1ShmoNox1em1ShmoNox4em1Shmo Resource Report Resource Website 1+ mentions |
RRID:RGD_598092603 | Rattus norvegicus | A 7-base deletion in the first exon of the NADPH oxidase 2 (Nox2) gene, a 29-base deletion in the first exon of the NADPH oxidase 1 (Nox1) gene, and a one-base insertion in the first exon of the NADPH oxidase 4 (Nox4) gene were introduced by CRISPR/Cas9 in the F344/DuCrj rats. They were then backcrossed to F344/N (Japan SLC, Inc.). This triple Nox knock rats were created by compound crossbreeding of single knockout rats (RGD:598092598, RGD:598092601, RGD:598092602). National BioResource Project for the Rat in Japan | 598092603 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2025-03-28) | 598092603 | 2026-09-05 06:52:46 | 2 | |||||
|
F344-Cybbem1Shmo Resource Report Resource Website |
RRID:RGD_598092601 | Rattus norvegicus | A 7-base deletion was introduced into the first exon of the NADPH oxidase 2 (Nox2)(official symbol:Cybb) gene of F344/DuCrj rats by CRISPR/Cas9. They were then backcrossed to F344/N (Japan SLC, Inc.). National BioResource Project for the Rat in Japan | 598092601 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2025-03-28) | 598092601 | 2026-09-05 06:52:46 | 0 | |||||
|
F344-Hspa8em2Opu Resource Report Resource Website |
RRID:RGD_598092577 | Rattus norvegicus | The Hspa8 mutation (c.284T>A) in the KK rat (NBRP Rat No. 0890) was inserted into the F344/Jcl. Knocking in of the mutant allele was performed by lsODN-mediated knock-in with the CRISPR-Cas9 system. The gRNA and PAM sequences are gtgccacaagctattaaatatatgg (PAM: tgg) and ccatttatggatgggctctctccc (PAM: cca). In KI rats, each PAM sequence is replaced by a silent mutation. Two lines were obtained from founder rats. In line 2, there are two SNPs in the intron where the upstream gRNA, but this is not related to the phenotype. This strain was produced with the support of the AdAMS (Advanced Animal Model Support). National BioResource Project for the Rat in Japan | 598092577 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2025-03-27) | 598092577 | 2026-09-05 06:52:46 | 0 | |||||
|
F344-Hspa8em1Opu Resource Report Resource Website |
RRID:RGD_598092574 | Rattus norvegicus | The Hspa8 mutation (c.284T>A) in the KK rat (NBRP Rat No. 0890)(RGD:598092575) was inserted into the F344/Jcl. Knocking in of the mutant allele was performed by lsODN-mediated knock-in with the CRISPR-Cas9 system. The gRNA and PAM sequences are gtgccacaagctattaaatatatgg (PAM: tgg) and ccatttatggatgggctctctccc (PAM: cca). In KI rats, each PAM sequence is replaced by a silent mutation. Two lines were obtained from founder rats. In line 1, there is one SNP in the intron where the upstream gRNA, but this is not related to the phenotype. This strain was produced with the support of the AdAMS (Advanced Animal Model Support). National BioResource Project for the Rat in Japan | 598092574 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2025-03-27) | 598092574 | 2026-09-05 06:52:46 | 0 | |||||
|
LEW-Col7a1em1Jtol-/- Resource Report Resource Website |
RRID:RGD_598130079 | Rattus norvegicus | The CRISPR/Cas9 system was used to introduce an 8-bp deletion in exon 1 of the Col7a1 gene of one-cell Lew/Crl rat embryos. The strain is deposited with RRRC (Rat Resource and Research Center) | 598130079 | mutant | Rat Genome Database (RGD) | RGD | Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2025-04-15) | 598130079 | 2026-09-05 06:52:47 | 0 | |||||
|
SS-Del(2q)1Mcwi -/- Resource Report Resource Website 1+ mentions |
RRID:RGD_401938598 | Rattus norvegicus | Four single guide RNAs and SpCas9 targeting sequences ATGAAGTGCCTAGCTTCATT, GAAGCTAGGCACTTCATCTA, ATTCATAATGGGACACTCGA, and CCCAGCCTCAGATTCATAAT flanking a chromosome 2 region distal to Npr3 were targeted in SS/JrHsdMcwi embryos. A 29,508 bp deletion in chromosome 2 (rn6: chr2:61,845,176-61,874,684) resulted, along with an insertion of 3 nucleotides (TGG). Please contact: [email protected] | 401938598 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2023-12-12) | 401938598 | 2026-09-05 06:52:47 | 1 | |||||
|
SD-Foxo4em1Soar+/+ Resource Report Resource Website |
RRID:RGD_405855877 | Rattus norvegicus | This is the wild type littermate from crossing of heterozygous mutant female rats with wild-type male rats to generate hemizygous null male rats and wild type mutant. Foxo4 mutant strain (RGD:405855876) was created in zygotes from Holtzman Sprague-Dawley. Guided RNAs targeting exon 2 (target sequence: CCAGATATACGAATGGATGGTCC; nucleotides 517-539) and exon 3 (target sequence: GTTCATCAAGGTACATAACGAGG; nucleotides 631-653) of the Foxo4 gene (NM_001106943.1)) were injected to the embryos to create a 3096-bp deletion including the 3' part of exon 2 and 5' part of exon 3, and resulting a premature stop of the protein. | 405855877 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 405855877 | 2026-09-05 06:52:46 | 0 | |||||
|
LE-Them2-2(cre)Koba Resource Report Resource Website |
RRID:RGD_598092588 | Rattus norvegicus | The T2A, nlsCre, and BGHpolyA are knocked in at the stop codon in the 13th exon of the tyrosine hydroxylase (TH) gene (NCBI Gene ID: 25085). National BioResource Project for the Rat in Japan | 598092588 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2025-03-27) | 598092588 | 2026-09-05 06:52:47 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
