Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=401717572
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals (as of 2023-08-07)
Alternate IDs: 401717572
Notes: CRISPR/SpCas9 system using sgRNA targeting the sequence CAGGGCCACGTGCAGATAGTCGG was used to introduce an 11-bp deletion (rn7: chr10:72,595,923-72,595,933) in exon 4 of the Mpo gene in Crl:SD strain rats.
Proper citation: RRID:RGD_401717572 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=155630635
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 155630635
Notes: The mutant rat was produced by injecting Crl:CD(SD) zygotes with gRNA +Cas9 ribonucleoprotein complex targeting exon 3 of rat Ctns. The founder of this strain possessed a 7-bp deletion which results in frameshift and pre-mature stop truncated protein.
Proper citation: RRID:RGD_155630635 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=401940195
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 401940195
Notes: The homozygous knockout rats were created using CRISPR/Cas9 gene editing to delete 10 bp of exon 2 of Ahr in Sprague Dawley rats .
Proper citation: RRID:RGD_401940195 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5688032
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Genomic Alteration: (null)
Availability: Unknown
Source References: (null)
Alternate IDs: 5688032
Notes: ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.
Proper citation: RRID:RGD_5688032 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10759544
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 10759544
Notes: this strain was produced by CRISPR/Cas9 system. The resulting knock-in mutation is R411W in exon 11 of the GCDH gene.
Proper citation: RRID:RGD_10759544 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=329969883
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 329969883
Notes: A pair of synthetic oligonucleotides for sgRNA (sgRNA1, CCTTGCCGCTTTAAGTGACTC; sgRNA2, CCATGTTGGGAGCATTGCCTA) were annealed and then cloned into the pUC57-sgRNA expression vector, and the floxed plasmid donor was cloned into the pGSI plasmid. Both the Cas9 and sgRNA expression plasmids were linearized and used as templates for in vitro transcription. A mixture of the donor vector (4ââ¬â¦ng/ul), Cas9 mRNA (25ââ¬â¦ng/ul), and sgRNAs (10ââ¬â¦ng/ul each) was microinjected into both the cytoplasm and male pronucleus of the fertilized eggs. The injected zygotes were then transferred to pseudopregnant SD rats, which then carried them to parturition. This is called conditional knockout Trim44 (Trim44 cKO).
Proper citation: RRID:RGD_329969883 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=401824639
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2025-11-22)
Alternate IDs: 401824639
Notes: Produced by injection of CRISPR/Cas9 targeting the genomic sequence GGTGAGATCCTTTGAAAAGG in Rag1 into double homozygous embryos with knockout of Fah and Il2rg produced following multiple generations of intercrossing strains SD-Il2rgem2Mcwi (RGDID:10002794) and SD-Fahem3Mcw (RGDID: 10002791). The resulting CRISPR-induced mutation in Rag1 deletes 25-bp (rn7: chr3:87,923,384-87,923,408) and inserts 17 bp (ACCCTAAACAGCTGTGC) for a net 8-bp deletion. availability contact: [email protected]
Proper citation: RRID:RGD_401824639 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=329848995
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2023-06-07)
Alternate IDs: 329848995
Notes: The kisspeptin gene (Kiss1) is knocked out conditonally by the Cre recombinase. This strain was generated by K.I. Maeda (The University of Tokyo), H. Tsukamura, Y. Uenoyama, N. Inoue (Nagoya University), and M. Hirabayashi (National Institute for Physiological Sciences) for the purpose of producing conditional knockout rats of the Kiss1 gene in the hypothalamus. The targeting vector (loxP, Kiss1[exons 2 and 3], PGK promoter-neo, loxP) was introduced by electroporation targeting the Kiss1 gene in ES cells (WDB/Nips-ES1/Nips). Crossed with and maintained by the Wistar-Imamichi rats (Iar:Wistar-Imamichi, Institute for Animal Reproduction). National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_329848995 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=329848994
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2023-06-21)
Alternate IDs: 329848994
Notes: Kiss1 knockout rats were generated by K.I. Maeda (The University of Tokyo), H. Tsukamura, Y. Uenoyama, N. Inoue (Nagoya University), and M. Hirabayashi (National Institute for Physiological Sciences). The targeting vector (tdTomato/puromycin N-acetyl transferase) was introduced by electroporation targeting the Kiss1 gene in ES cells (WDB/Nips-ES1/Nips). Crossed with and maintained by the Wistar-Imamichi rats (Iar:Wistar-Imamichi, Institute for Animal Reproduction). National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_329848994 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=401795484
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2023-09-11)
Alternate IDs: 401795484
Notes: Exon 1 of Slc30a10 was targeted using CRISPR/Cas9 in the Crl:CD(SD) embryos . A mosiac founder that transmitted a 248 bp deletion in exon 1 of Slc30a10 leading to an out of frame mutation after amino acid 22 was bred to a CD rat to select for the above deletion and establish the line. The strain will be deposited to RRRC.
Proper citation: RRID:RGD_401795484 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=405650195
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 405650195
Notes: This is the wild type littermate from the crossing of heterozygous Esr1 mutant rats. This wild type littermate rat was used as a control for the homozygous mutant SD-Esr1em1-/- (RGD:405649860) in estrogen receptor study. Department of Medicine, Division of Pulmonary, Critical Care, Sleep and Occupational Medicine, Indiana University School of Medicine, Indianapolis, Indiana, USA.
Proper citation: RRID:RGD_405650195 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=598092602
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2025-03-28)
Alternate IDs: 598092602
Notes: A one-base insertion was introduced into the first exon of the NADPH oxidase 4 (Nox4) gene of F344/DuCrj rats by CRISPR/Cas9. They were then backcrossed to F344/N (Japan SLC, Inc.). National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_598092602 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=598092603
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2025-03-28)
Alternate IDs: 598092603
Notes: A 7-base deletion in the first exon of the NADPH oxidase 2 (Nox2) gene, a 29-base deletion in the first exon of the NADPH oxidase 1 (Nox1) gene, and a one-base insertion in the first exon of the NADPH oxidase 4 (Nox4) gene were introduced by CRISPR/Cas9 in the F344/DuCrj rats. They were then backcrossed to F344/N (Japan SLC, Inc.). This triple Nox knock rats were created by compound crossbreeding of single knockout rats (RGD:598092598, RGD:598092601, RGD:598092602). National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_598092603 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=598092601
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2025-03-28)
Alternate IDs: 598092601
Notes: A 7-base deletion was introduced into the first exon of the NADPH oxidase 2 (Nox2)(official symbol:Cybb) gene of F344/DuCrj rats by CRISPR/Cas9. They were then backcrossed to F344/N (Japan SLC, Inc.). National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_598092601 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=598092577
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2025-03-27)
Alternate IDs: 598092577
Notes: The Hspa8 mutation (c.284T>A) in the KK rat (NBRP Rat No. 0890) was inserted into the F344/Jcl. Knocking in of the mutant allele was performed by lsODN-mediated knock-in with the CRISPR-Cas9 system. The gRNA and PAM sequences are gtgccacaagctattaaatatatgg (PAM: tgg) and ccatttatggatgggctctctccc (PAM: cca). In KI rats, each PAM sequence is replaced by a silent mutation. Two lines were obtained from founder rats. In line 2, there are two SNPs in the intron where the upstream gRNA, but this is not related to the phenotype. This strain was produced with the support of the AdAMS (Advanced Animal Model Support). National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_598092577 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=598092574
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2025-03-27)
Alternate IDs: 598092574
Notes: The Hspa8 mutation (c.284T>A) in the KK rat (NBRP Rat No. 0890)(RGD:598092575) was inserted into the F344/Jcl. Knocking in of the mutant allele was performed by lsODN-mediated knock-in with the CRISPR-Cas9 system. The gRNA and PAM sequences are gtgccacaagctattaaatatatgg (PAM: tgg) and ccatttatggatgggctctctccc (PAM: cca). In KI rats, each PAM sequence is replaced by a silent mutation. Two lines were obtained from founder rats. In line 1, there is one SNP in the intron where the upstream gRNA, but this is not related to the phenotype. This strain was produced with the support of the AdAMS (Advanced Animal Model Support). National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_598092574 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=598130079
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2025-04-15)
Alternate IDs: 598130079
Notes: The CRISPR/Cas9 system was used to introduce an 8-bp deletion in exon 1 of the Col7a1 gene of one-cell Lew/Crl rat embryos. The strain is deposited with RRRC (Rat Resource and Research Center)
Proper citation: RRID:RGD_598130079 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=401938598
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2023-12-12)
Alternate IDs: 401938598
Notes: Four single guide RNAs and SpCas9 targeting sequences ATGAAGTGCCTAGCTTCATT, GAAGCTAGGCACTTCATCTA, ATTCATAATGGGACACTCGA, and CCCAGCCTCAGATTCATAAT flanking a chromosome 2 region distal to Npr3 were targeted in SS/JrHsdMcwi embryos. A 29,508 bp deletion in chromosome 2 (rn6: chr2:61,845,176-61,874,684) resulted, along with an insertion of 3 nucleotides (TGG). Please contact: [email protected]
Proper citation: RRID:RGD_401938598 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=405855877
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 405855877
Notes: This is the wild type littermate from crossing of heterozygous mutant female rats with wild-type male rats to generate hemizygous null male rats and wild type mutant. Foxo4 mutant strain (RGD:405855876) was created in zygotes from Holtzman Sprague-Dawley. Guided RNAs targeting exon 2 (target sequence: CCAGATATACGAATGGATGGTCC; nucleotides 517-539) and exon 3 (target sequence: GTTCATCAAGGTACATAACGAGG; nucleotides 631-653) of the Foxo4 gene (NM_001106943.1)) were injected to the embryos to create a 3096-bp deletion including the 3' part of exon 2 and 5' part of exon 3, and resulting a premature stop of the protein.
Proper citation: RRID:RGD_405855877 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=598092588
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2025-03-27)
Alternate IDs: 598092588
Notes: The T2A, nlsCre, and BGHpolyA are knocked in at the stop codon in the 13th exon of the tyrosine hydroxylase (TH) gene (NCBI Gene ID: 25085). National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_598092588 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.