Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
SD-Mecp2em1Sage/Hsd Resource Report Resource Website 1+ mentions |
RRID:RGD_156430169 | Rattus norvegicus | The MeCP2 KO rat model was originally created at SAGE Labs, Inc. in St. Louis, MO and distributed out of the Boyertown, PA facility. The line continues to be maintained through the original SAGE Labs animal inventory acquired by Envigo. The ZFN mutant rat strain was produced by injecting zinc finger nuclease targeting rat Mecp2 into Sprague Dawley embryos. This mutant rat has a knockout of the methyl CpG binding protein 2 (Mecp2). ENVIGO | 156430169 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Embryo (as of 2023-02-22) | 156430169 | 2026-09-05 06:52:44 | 2 | |||||
|
SS-Chr 3BN.SS-(D3Rat 86-D3Rat218).Il2rgem1/Mcwi Resource Report Resource Website |
RRID:RGD_155791440 | Rattus norvegicus | Immunodeficient subcongenic line developed by intercross SS-Chr 3BN.SS-(D3Rat222-D3Rat218).Il2rgem1Mcwi/Mcwi (RGD:155791433) heterozygous congenic, Il2rg null mutant (X-SCID) lines. Contact MCW rat distribution at [email protected] for availability. | 155791440 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 155791440 | 2026-09-05 06:52:45 | 0 | |||||
|
WI;WDB-ROSA26tm1(H2B-tdTomato)/Nips Resource Report Resource Website |
RRID:RGD_155269039 | Rattus norvegicus | PCR products of the human H2BC11 (H2B-6), tdTomato, splice acceptor sequence, and IRES-Neor-SV40pA were inserted into the NheI site of prROSA26-1 with an in-fusion cloning kit. The final tdTomato-H2B-6 targeting vector was linearized by SalI digestion. The vector was introduced into WDB/Nips-ES1/Nips (RGD ID:10054010) embryonic stem cells by electroporation. Targeted ES cells were injected into Crlj:WI (RGD ID: 2312504) blastocysts to produce chimeric rats. The chimeric rats were crossed with Crlj:WI rats to produce heterozygous founder rats.These rat strains are being maintained by crossing the founder rats with Crlj:WI rats. ROSA26 is a synonym for rat Thumpd3-as1 (RGD:6491660) and is used as an official symbol for rat strain nomenclature. Section of Mammalian Transgenesis Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, Okazaki Aichi, JAPAN | 155269039 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Embryo (as of 2022-10-11) | 155269039 | 2026-09-05 06:52:45 | 0 | |||||
|
SS-Del(1q)2Mcwi Resource Report Resource Website |
RRID:RGD_404976873 | Rattus norvegicus | Four single guide RNAs and SpCas9 targeting sequences CTTCATTGTATGAGCAGCCG, TTTGAAAGAGACAGCTGCCT, ACGCACGTCGGACAGTTCCA, and GGCTTATTGCGCACGCACGT flanking a chromosome 1 region were targeted in SS/JrHsdMcwi embryos. An 82-bp deletion in chromosome 1 (rn7: chr1:255,749,164-255,749,245) resulted. Please contact: [email protected] | 404976873 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2024-03-18) | 404976873 | 2026-09-05 06:52:46 | 0 | |||||
|
SS-Mmp2em2Mcwi+/+ Resource Report Resource Website |
RRID:RGD_5688037 | Rattus norvegicus | ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. | (null) | (null) | 5688037 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 5688037 | 2026-09-05 06:52:45 | 0 | |||
|
SS-Mmp2em2Mcwi-/- Resource Report Resource Website |
RRID:RGD_5688034 | Rattus norvegicus | ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. | (null) | (null) | 5688034 | mutant | Rat Genome Database (RGD) | RGD | Live Animals (as of 2017-07-18) | 5688034 | 2026-09-05 06:52:45 | 0 | |||
|
SD-Foxo4em1Soar Resource Report Resource Website |
RRID:RGD_405855876 | Rattus norvegicus | This Foxo4 mutant strain was created in zygotes from Holtzman Sprague-Dawley. Guided RNAs targeting exon 2 (target sequence: CCAGATATACGAATGGATGGTCC; nucleotides 517-539) and exon 3 (target sequence: GTTCATCAAGGTACATAACGAGG; nucleotides 631-653) of the Foxo4 gene (NM_001106943.1)) were injected to the embryos to create a 3096-bp deletion including the 3' part of exon 2 and 5' part of exon 3, and resulting a premature stop of the protein. | 405855876 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 405855876 | 2026-09-05 06:52:46 | 0 | |||||
|
LEW-Chrna4em5Mcwi Resource Report Resource Website |
RRID:RGD_12790615 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the Chrna4 gene of LEW/Crl rat embryos. The resulting mutation is a 4-bp deletion in the Chrna4 gene. Contact MCW rat distribution at [email protected] | 12790615 | mutant | Rat Genome Database (RGD) | RGD | Live Animals; Cryorecovery (as of 2017-02-17) | 12790615 | 2026-09-05 06:52:45 | 0 | |||||
|
SS-Cd247em1Mcwi Resource Report Resource Website 1+ mentions |
RRID:RGD_6484582 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence CTCGCCTGCATCCTTCAAGtgcagtTCCCAGGAGCAGGTAAGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 11-bp frameshift deletion in exon 1. | 6484582 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2021-11-03) | 6484582 | 2026-09-05 06:52:45 | 1 | |||||
|
LE-Fmr1em1Sidb Resource Report Resource Website |
RRID:RGD_405100226 | Rattus norvegicus | Colony founders were produced by SAGE (Sigma Advanced Genetic Engineering) Labs using ZFN-mediated disruption of Fmr1 with a targeted construct containing coding sequence for eGFP; resulting founders did not express FMRP or eGFP. Simons Initiative for the Developing Brain (SIDB), Institute for Neuroscience and Cardiovascular Research, University of Edinburgh, Edinburgh EH8 9XD, UK. Contact SIDB Scientific Officer for enquiries on rat distribution ([email protected]). | 405100226 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 405100226 | 2026-09-05 06:52:46 | 0 | |||||
|
SS-Chr 3BN.SS-(D3Mgh13-D3Rat218).Il2rgem1/Mcwi Resource Report Resource Website |
RRID:RGD_155791439 | Rattus norvegicus | Immunodeficient subcongenic line developed by intercross SS-Chr 3BN.SS-(D3Rat222-D3Rat218).Il2rgem1Mcwi/Mcwi (RGD:155791433) heterozygous congenic, Il2rg null mutant (X-SCID) lines. Contact MCW rat distribution at [email protected] for availability. | 155791439 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 155791439 | 2026-09-05 06:52:45 | 0 | |||||
|
SD-Fosem1Yossi Resource Report Resource Website |
RRID:RGD_329849011 | Rattus norvegicus | SD rats (Slc:SD) in which the c-Fos gene (ENSRNOG00000008015) was disrupted by the CRISPR/Cas9 system. Two guide RNAs and Cas9 protein were injected into the pronucleus of fertilized eggs of SD rats. After injection, they were transferred into the oviducts of the recipient rats and born. The founder rat (line 12) showed abnormal teeth, and PCR and sequencing analysis revealed that 1,067 bases including Exon 1 were deleted. The founder rat were mated with SD rats and bred. National BioResource Project for the Rat in Japan | 329849011 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2023-06-09) | 329849011 | 2026-09-05 06:52:45 | 0 | |||||
|
SD-Slc9a6 em1Moro/Rrrc Resource Report Resource Website |
RRID:RGD_401938647 | Rattus norvegicus | Crispr-Cas was used to introduce a 2bp insertion of TT to create a stop codon in exon 7 of SLC9a6 gene, causing termination of translation. The strain was rederived at RRRC. deposited at RRRC | 401938647 | mutant | Rat Genome Database (RGD) | RGD | Live Animals (as of 2023-12-18) | 401938647 | 2026-09-05 06:52:45 | 0 | |||||
|
F344-TyrCKitH/Hkv Resource Report Resource Website |
RRID:RGD_329849009 | Rattus norvegicus | F344-TyrC KitH/Kyo (Black F344, NBRP Rat No. 0768, aka RGD:11040971), carrying 1) point mutation in the exon 2 (896G>A, p.R229H) of Tyrosinase (Tyr) gene (albino phenotype) and 2) retrotransposon insertion (7-bp) in kit gene (hooded phenotype) induced was crossed with F344/NSlc (Japan SLC, Inc.). Then, from the F2 generation, Tyr as a wild-type homozygous (confirmed by sequence) and Kit as a hooded homozygous (confirmed by phenotype) were selected. National BioResource Project for the Rat in Japan | 329849009 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2023-06-09) | 329849009 | 2026-09-05 06:52:45 | 0 | |||||
|
LE-Pvalbem2(cre)Koba Resource Report Resource Website |
RRID:RGD_329849003 | Rattus norvegicus | A complex of Cas9 protein and gRNA was introduced into Iar:LE fertilized rat eggs by electroporation. Combi-CRISPR (Yoshimi K. et al.) was used to induce knock-in. Knock-in rats were selected and crossed with wild-type rats to establish this strain. Sequence features: the intron just before the fourth exon of the Pvalb gene (intron 3) is deleted by NHEJ after double-strand break by one base compared to the wild-type. ---ttggcgggccagaacctcagggg---(wild-type) ---ttggcgggccagaacc-cagggg---(knock-in) National BioResource Project for the Rat in Japan | 329849003 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 329849003 | 2026-09-05 06:52:45 | 0 | |||||
|
WKY-Col4a5em3Matsu Resource Report Resource Website |
RRID:RGD_329845600 | Rattus norvegicus | Genome editing was performed using the rGONAD method to produce three different lines of KO rats due to three different genome mutations thus different in protein expression predication. The genetic background is WKY/NCrlCrlj (Charles River Laboratories Japan) (RGD:61119). Tandem STOP codons were designed to integrate into 27 bases after the first ATG in the rat Col4a5 gene This em3 mutant carries a deletion of 56 base pairs containing the first methioine. Col4α5 em3 ratshave urinary protein and hematuria from early on, and males begin to die at 18 weeks of age and all die by 28 weeks of age. National BioResource Project for the Rat in Japan | 329845600 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 329845600 | 2026-09-05 06:52:45 | 0 | |||||
|
LEW-Chrna3em1Mcwi Resource Report Resource Website |
RRID:RGD_10054373 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the Chrna3 gene of LEW/NCrl rat embryos.The resulting mutation is a 1-bp (G) insertion in the Chrna3 gene. Contact MCW rat distribution at [email protected] | 10054373 | mutant | Rat Genome Database (RGD) | RGD | Unknown (as of 2018-10-22) | 10054373 | 2026-09-05 06:52:45 | 0 | |||||
|
SD-Pde3aem3Bdr Resource Report Resource Website |
RRID:RGD_155631298 | Rattus norvegicus | The rat mutant was generated by pronuclear microinjection of Sprague-Dawley rat zygotes with a mixture of Cas9/Cas9 system to target the catalytic domain in the rat Pde3a gene. The model has a carriesa CGT to TGD missense mutation and results in R862C substitutions in the protein | 155631298 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 155631298 | 2026-09-05 06:52:45 | 0 | |||||
|
SD-Ahrem1Iexas+/- Resource Report Resource Website |
RRID:RGD_401940197 | Rattus norvegicus | The Ahr heterozygous rats were created using CRISPR/Cas9 gene editing to delete 10 bp of exon 2 of Ahr in Sprague Dawley rats . | 401940197 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 401940197 | 2026-09-05 06:52:45 | 0 | |||||
|
SS-Xdhem1Mcwi+/- Resource Report Resource Website |
RRID:RGD_405849408 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a 7-bp deletion in exon 4 of rat Xdh gene in the SS/JrHsdMcwi embryos. This is a heterozygous strain which has decreased Xdh protein detected in the kidney cortex tissue as compared to the wild type littermate at 6-week old. Contact MCW rat distribution at [email protected] | 405849408 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 405849408 | 2026-09-05 06:52:46 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
