Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

On page 19 showing 361 ~ 380 out of 64,152 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:WB-STRAIN:WBStrain00037034

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00037034

Source Database: WormBase (WB)
Affected Genes: WBGene00001461(flp-18)
Genomic Alteration: WBGene00001461(flp-18)
Availability: available
Source References: EMPTY
Synonyms: flp-18(gk3063) X.
Alternate IDs: WB-STRAIN:VC2016, CGC_VC2016
Notes: Made_by: Vancouver KO Group|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y48D7A.2. External left primer: TGTGCCACTCACCGATGACAC. External right primer: CATCATCATGGCGCTACG. Internal left primer: GTCCTATCAGTACCTCATGGG. Internal right primer: CGAATACCTTGTACACGC. Internal WT amplicon: 2980 bp. Deletion size: 1312 bp. Deletion left flank: AACACACGTCAACCATGAACAAATCTGCTT. Deletion right flank: AAATTTCAAATTCATGCTTTCAAATCGACA."

Proper citation: RRID:WB-STRAIN:WBStrain00037034 Copy   


  • RRID:WB-STRAIN:WBStrain00037031

http://www.wormbase.org/db/get?name=WBStrain00037031

Source Database: WormBase (WB)
Affected Genes: WBGene00006829(unc-101)|WBGene00013020(ndrr-1)
Genomic Alteration: WBGene00006829(unc-101), WBGene00013020(ndrr-1)
Availability: available
Source References: EMPTY
Synonyms: Y48G10A.3(ok2508)/hIn1 [unc-101(sy241)] I.
Alternate IDs: WB-STRAIN:VC2011, CGC_VC2011
Notes: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"Y48G10A.3. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok2508 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GTGGATGGTTTTCGCAGTTT. External right primer: TGACATGCAGCCTCTAATGG. Internal left primer: ATTCTGCGTCTCCTGCATCT. Internal right primer: AAAAGTGAACACGGCCTTTG. Internal WT amplicon: 2246 bp. Deletion size: 1628 bp. Deletion left flank: AAAAGAGCATCATGCTCTCCGTCACAGCGT. Deletion right flank: TTTTAAAAAAGTTTTGGTTTTTTTTTTAAA."

Proper citation: RRID:WB-STRAIN:WBStrain00037031 Copy   


  • RRID:WB-STRAIN:WBStrain00037032

http://www.wormbase.org/db/get?name=WBStrain00037032

Source Database: WormBase (WB)
Affected Genes: WBGene00012473(Y17G7B.22)|WBGene00016114(flp-27)
Genomic Alteration: WBGene00012473(Y17G7B.22), WBGene00016114(flp-27)
Availability: available
Source References: EMPTY
Synonyms: flp-27(gk3331) Y17G7B.22(gk1062) II; gkDf45 X.
Alternate IDs: WB-STRAIN:VC2012, CGC_VC2012
Notes: Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain is homozygous for a deletion (gk1062) in Y17G7B.22, detectable by PCR using the following primers. External left primer: CCCGTAGTTCATCGATTGCT. External right primer: AAAAAGAATACCACCGGCCT. Internal left primer: ATCTGTTGCCTTCTGTTGGG. Internal right primer: TCGCAGGAGTTTGGGTACTT. Internal WT amplicon: 2119 bp. Deletion size: 1412 bp. Deletion left flank: AAATAGACTATTTCGGAAAATGGAAATGAG. Deletion right flank: AAAATTATTGATTTTGACCCCAAAAATTTA. Insertion Sequence: TTGT. Validation: gk1062 passed by diagnostic PCR and CGH. Other deletions (gk3331, gkDf45) identified by CGH."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037032 Copy   


  • RRID:WB-STRAIN:WBStrain00037037

http://www.wormbase.org/db/get?name=WBStrain00037037

Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00015143(rbm-26)
Genomic Alteration: WBGene00000254(bli-4), WBGene00015143(rbm-26)
Availability: available
Source References: EMPTY
Synonyms: B0336.3(gk910) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC2019, CGC_VC2019
Notes: B0336.3. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk910 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GTACCCCATTGGTTCCTCCT. External right primer: TCAATTCCATCTCGAGGTCC. Internal left primer: ATTCTCGCATTTCTTTGCGT. Internal right primer: ATTTGGGCTGCAATCTCATC. Internal WT amplicon: 2166 bp. Deletion size: 408 bp. Deletion left flank: ATGGTTCCACTCCCGGCTACCGCTCCTAAT. Deletion right flank: CTTCAAGTTGCCAAGATTCCACCAGAGATG.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037037 Copy   


  • RRID:WB-STRAIN:WBStrain00037038

http://www.wormbase.org/db/get?name=WBStrain00037038

Source Database: WormBase (WB)
Affected Genes: WBGene00022774(swsn-6)|WBGene00022776(perm-3)
Genomic Alteration: WBGene00022774(swsn-6), WBGene00022776(perm-3)
Availability: available
Source References: EMPTY
Synonyms: ZK616.6&ZK616.4(ok2654) IV/nT1 [qIs51] (IV;V).
Alternate IDs: WB-STRAIN:VC2024, CGC_VC2024
Notes: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"ZK616.4, ZK616.6. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2654 homozygotes (mid-larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGTCTGTCCCATGTCTGCTC. External right primer: TGTTACAATTTGATGGCGGA. Internal left primer: CGGAATTCAAAATCCTGGAA. Internal right primer: TTCAGGGGTTCTCTTGGTTG. Internal WT amplicon: 3222 bp. Deletion size: 1966 bp. Deletion left flank: AAGACCGATTGCTCCGAGGTTTCCAAGGCA. Deletion right flank: TACAAGTATTGATATGGACTACGTCGACAA."

Proper citation: RRID:WB-STRAIN:WBStrain00037038 Copy   


  • RRID:WB-STRAIN:WBStrain00037035

http://www.wormbase.org/db/get?name=WBStrain00037035

Source Database: WormBase (WB)
Affected Genes: WBGene00007372(C06B8.7)
Genomic Alteration: WBGene00007372(C06B8.7)
Availability: available
Source References: EMPTY
Synonyms: C06B8.7(ok2521) V/nT1 [qIs51] (IV;V).
Alternate IDs: WB-STRAIN:VC2017, CGC_VC2017
Notes: C06B8.7. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2521 homozygotes (probable embryonic arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Note that ok2521 was subsequently isolated as a viable homozygote (VC2085), so the lethality in this strain is not a consequence of the deletion. External left primer: TCACAGAGCGATGGTACTCG. External right primer: CCACCTCGAACCGTTTTCTA. Internal left primer: TGCAGATTCAAACCCATCAA. Internal right primer: TCCAACATTCCTTGCGTGTA. Internal WT amplicon: 1163 bp. Deletion size: 540 bp. Deletion left flank: AGCCAACGGCATGCTGGTTATGCTCACCTT. Deletion right flank: TGTGACTTAAGACTTTCTGGCAATGATTCT. Insertion Sequence: T.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037035 Copy   


  • RRID:WB-STRAIN:WBStrain00037036

http://www.wormbase.org/db/get?name=WBStrain00037036

Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00008887(tbcd-1)
Genomic Alteration: WBGene00000254(bli-4), WBGene00008887(tbcd-1)
Availability: available
Source References: EMPTY
Synonyms: F16D3.4(ok2634) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC2018, CGC_VC2018
Notes: F16D3.4. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2634 homozygotes (mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGCGGGAGATTCAAATAAGG. External right primer: TTTTGCAGCAATGGATGAAG. Internal left primer: CAAAACGCGTCTCCATTTTT. Internal right primer: ATGCACCAGTCGATGAGTCG. Internal WT amplicon: 1161 bp. Deletion size: 464 bp. Deletion left flank: CCGTCAAAACTCTCCGATCAACGTGTTTGA. Deletion right flank: CGTACAATACACAAATCAGAAAGATATTTC. Insertion Sequence: CAAATACACAAATCAGAAAGATATTT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037036 Copy   


  • RRID:WB-STRAIN:WBStrain00037040

http://www.wormbase.org/db/get?name=WBStrain00037040

Source Database: WormBase (WB)
Affected Genes: WBGene00003677(nhr-87)
Genomic Alteration: WBGene00003677(nhr-87)
Availability: available
Source References: EMPTY
Synonyms: nhr-87(gk1283) IV.
Alternate IDs: WB-STRAIN:VC2027, CGC_VC2027
Notes: Made_by: Vancouver KO Group|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y41D4B.7. External left primer: GAAACCACAAATTACCCCCA. External right primer: AACCACATTTCGGCTGTTTC. Internal left primer: CACTTCATAGTGTGGGCGTG. Internal right primer: AGGATTCCGATTGACCTTCC. Internal WT amplicon: 2253 bp. Deletion size: 1371 bp. Deletion left flank: AAGTGACGTCACACTTCATAGTGTGGGCGT. Deletion right flank: ATAACTTACAGAGTGATGAAAGGAACGTGT."

Proper citation: RRID:WB-STRAIN:WBStrain00037040 Copy   


  • RRID:WB-STRAIN:WBStrain00037041

http://www.wormbase.org/db/get?name=WBStrain00037041

Source Database: WormBase (WB)
Affected Genes: WBGene00016289(lntl-1)
Genomic Alteration: WBGene00016289(lntl-1)
Availability: available
Source References: EMPTY
Synonyms: lntl-1(ok1824) IV.
Alternate IDs: WB-STRAIN:VC2028, CGC_VC2028
Notes: C31H1.6. External left primer: CCAAAGTCTCCTGCCCATTA. External right primer: ACATACCACCCGCTTTCTTG. Internal left primer: TTCAAACAATGATACCCGCA. Internal right primer: TTTTGAGGGAAATGCGAAAC. Internal WT amplicon: 2666 bp. Deletion size: 1550 bp. Deletion left flank: TTACAGGTCCATCAAAGCGGAATCCTTTAG. Deletion right flank: TTTTTGTTCAGGAAACTTTGAAACGCACAT. Insertion Sequence: TACGGACCTCGTTTGAATTTCAATCATCTTCATCAGCAACAACAGTTGCAGTGAGTTTT TGGGAAAATTTTTTTGAAAGTATAAATATTCGTTTTAGTTCAACAATCATTCCTTCGGA GTATCTCGGAGACAAGTCAGGATTTGAGTCCAGGTAAGGGATGAAGAAGGCAATTCCAA AAAATTTTTAAACAAAAAACGACTGTTTCACGGTGCTATTATAACAAAACCATATGAAT GTGATTTGGTTCGAACCATGCCTTTGCCATTTTTAAAACATCATTATAAATAGTTCTGC AAATTAATATTACAGAACTCTTCCATCGGAATCTATTATGTCAGCCAACAGCAGCAGTC TTGGATCTCACTGGAAGAGAATTGATTCGTTCACTAGTGGAAAATCTACCCAATCAATT CCCACTACAATTTCTTCGAAACCTCTAACTATTCCTTCATCGATTTCTGCCAACACCGC TTCCATCCCACCAAATCATGGTTCAGAATTTTCGAAAGATTTCAAGATGTCATCCTCAT CGAGCATGACTAGTGAGTATTCGGAAACCATCCATGGAAACTCGTTGGCATCTCTGGCT CCATCGTCACAAATATTGAGCTCTTTGGTTGAAACTACTGAGAATC.|"C31H1.6. External left primer: CCAAAGTCTCCTGCCCATTA. External right primer: ACATACCACCCGCTTTCTTG. Internal left primer: TTCAAACAATGATACCCGCA. Internal right primer: TTTTGAGGGAAATGCGAAAC. Internal WT amplicon: 2666 bp. Deletion size: 1550 bp. Deletion left flank: TTACAGGTCCATCAAAGCGGAATCCTTTAG. Deletion right flank: TTTTTGTTCAGGAAACTTTGAAACGCACAT. Insertion Sequence: TACGGACCTCGTTTGAATTTCAATCATCTTCATCAGCAACAACAGTTGCAGTGAGTTTTTGGGAAAATTTTTTTGAAAGTATAAATATTCGTTTTAGTTCAACAATCATTCCTTCGGAGTATCTCGGAGACAAGTCAGGATTTGAGTCCAGGTAAGGGATGAAGAAGGCAATTCCAAAAAATTTTTAAACAAAAAACGACTGTTTCACGGTGCTATTATAACAAAACCATATGAATGTGATTTGGTTCGAACCATGCCTTTGCCATTTTTAAAACATCATTATAAATAGTTCTGCAAATTAATATTACAGAACTCTTCCATCGGAATCTATTATGTCAGCCAACAGCAGCAGTCTTGGATCTCACTGGAAGAGAATTGATTCGTTCACTAGTGGAAAATCTACCCAATCAATTCCCACTACAATTTCTTCGAAACCTCTAACTATTCCTTCATCGATTTCTGCCAACACCGCTTCCATCCCACCAAATCATGGTTCAGAATTTTCGAAAGATTTCAAGATGTCATCCTCATCGAGCATGACTAGTGAGTATTCGGAAACCATCCATGGAAACTCGTTGGCATCTCTGGCTCCATCGTCACAAATATTGAGCTCTTTGGTTGAAACTACTGAGAATC."|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037041 Copy   


  • RRID:WB-STRAIN:WBStrain00037045

http://www.wormbase.org/db/get?name=WBStrain00037045

Source Database: WormBase (WB)
Affected Genes: WBGene00001962(hlh-19)|WBGene00006788(unc-53)
Genomic Alteration: WBGene00001962(hlh-19), WBGene00006788(unc-53)
Availability: available
Source References: EMPTY
Synonyms: unc-53(gk3156) II; gkDf26 V; hlh-19(gk1069) X.
Alternate IDs: WB-STRAIN:VC2036, CGC_VC2036
Notes: Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"T04H1.1, F45E10.1, F57C12.3, T04H1.3, T04H1.2. The gk1069 allele was identified by PCR and validated by CGH, and can be detected with PCR using the following primers. External left primer: AAGGAACCTGCGGGATAACT. External right primer: CTTCCAGTAGGCAGTCAGGC. Internal left primer: CTGCTCCTCTTCCACGAGAC. Internal right primer: CCTTGTGTCCGAGTCCTCAT. Internal WT amplicon: 2234 bp. Deletion size: 716 bp. Deletion left flank: AATTGGTTTTTTTGATAAAGTTTGATTAGT. Deletion right flank: TTTCCAATATTTCATCAATTATTTGAACGC. Other lesions identified by CGH."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037045 Copy   


  • RRID:WB-STRAIN:WBStrain00037042

http://www.wormbase.org/db/get?name=WBStrain00037042

Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00011109(gpch-1)
Genomic Alteration: WBGene00000254(bli-4), WBGene00011109(gpch-1)
Availability: available
Source References: EMPTY
Synonyms: R07E5.1(ok2653) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC2031, CGC_VC2031
Notes: R07E5.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2653 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCTTTTTGGGCCATTTTGAG. External right primer: CCATTTTCACAGCGGCTAAT. Internal left primer: AATTAATTTTTCCAGGCGGC. Internal right primer: CACAAATTTCGAAGCCATCA. Internal WT amplicon: 1186 bp. Deletion size: 399 bp. Deletion left flank: ATTTGCTAAAGTTTGAGTTTACGGGTTTTT. Deletion right flank: CTGTCTGGGAGTGGGAGTGGGAAAAGAAAG. Insertion Sequence: T.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037042 Copy   


  • RRID:WB-STRAIN:WBStrain00037043

http://www.wormbase.org/db/get?name=WBStrain00037043

Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00009899(efl-3)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00009899(efl-3)
Availability: available
Source References: EMPTY
Synonyms: F49E12.6(gk896)/mIn1 [mIs14 dpy-10(e128)] II.
Alternate IDs: WB-STRAIN:VC2033, CGC_VC2033
Notes: F49E12.6. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk896 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TGCTCTGGGAACTCTTCGAT. External right primer: GGAGTGGTCGGTGTTGAAGT. Internal left primer: TATTTGGTGACGTGGCATTG. Internal right primer: CCACGTGGTGATGACAACTC. Internal WT amplicon: 2404 bp. Deletion size: 1777 bp. Deletion left flank: GTTTTGGGAATAAAGCATCTCACAAATAAA. Deletion right flank: CGAATCTACGATATTGTCAATGTAATGGAA.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037043 Copy   


  • RRID:WB-STRAIN:WBStrain00037005

http://www.wormbase.org/db/get?name=WBStrain00037005

Source Database: WormBase (WB)
Affected Genes: WBGene00018042(mks-3)
Genomic Alteration: WBGene00018042(mks-3)
Availability: available
Source References: PMID:38302462
Synonyms: F35D2.4(ok2142) II.
Alternate IDs: WB-STRAIN:VC1977, CGC_VC1977
Notes: F35D2.4. External left primer: CAAGAAAGCCAACAACTCCC. External right primer: TCGTTCACGAAACATTGCAT. Internal left primer: TTCAAATGAAGTCCAAGCCC. Internal right primer: GCCCTTCACAAAGCACTCTC. Internal WT amplicon: 2754 bp. Deletion size: 1217 bp. Deletion left flank: TGAGAGATAGACAAAAATTGTAACCGCTAA. Deletion right flank: AAATGGAGCAAATGGGTTCAGAGAGTCATC.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037005 Copy   


  • RRID:WB-STRAIN:WBStrain00037002

http://www.wormbase.org/db/get?name=WBStrain00037002

Source Database: WormBase (WB)
Affected Genes: WBGene00017176(nmur-3)
Genomic Alteration: WBGene00017176(nmur-3)
Availability: available
Source References: EMPTY
Synonyms: F02E8.2(ok2295) X.
Alternate IDs: WB-STRAIN:VC1974, CGC_VC1974
Notes: F02E8.2. External left primer: GACGGTGCTCATTCTTCCAT. External right primer: GAGTGGTGGATTGGGAAAGA. Internal left primer: CCAGTCCATTGCTCAATTCC. Internal right primer: CAAGCGGGTCGTTTATTTGT. Internal WT amplicon: 2195 bp. Deletion size: 1115 bp. Deletion left flank: ACTTTTATTGTGAGTTGTGCATTGCAGTTT. Deletion right flank: ACATTTTCTTTGTATTACAGTAAATTTAAG.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037002 Copy   


  • RRID:WB-STRAIN:WBStrain00037006

http://www.wormbase.org/db/get?name=WBStrain00037006

Source Database: WormBase (WB)
Affected Genes: WBGene00011975(golg-5)
Genomic Alteration: WBGene00011975(golg-5)
Availability: available
Source References: EMPTY
Synonyms: T24B1.1(ok2604) I.
Alternate IDs: WB-STRAIN:VC1978, CGC_VC1978
Notes: Made_by: Vancouver KO Group|"T24B1.1. External left primer: ACCGAACTTGACGAATCCAC. External right primer: TGAACAGGACGATCACTGGA. Internal left primer: TAAAGTGTCCGATATTGCCG. Internal right primer: TCCGATTCCTTGCTGAATTG. Internal WT amplicon: 1116 bp. Deletion size: 494 bp. Deletion left flank: GTTATCACTGAAGATTTCGGCAGACCGGCT. Deletion right flank: GAAAACCAAAAAGTATCAAGTCATGAAATG. Insertion Sequence: AAAGACCG."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037006 Copy   


  • RRID:WB-STRAIN:WBStrain00037096

http://www.wormbase.org/db/get?name=WBStrain00037096

Source Database: WormBase (WB)
Affected Genes: WBGene00012638(Y38H8A.4)
Genomic Alteration: WBGene00012638(Y38H8A.4)
Availability: available
Source References: EMPTY
Synonyms: Y38H8A.4(ok2793) IV.
Alternate IDs: WB-STRAIN:VC2128, CGC_VC2128
Notes: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"Y38H8A.4. External left primer: CACTTCCCCCAGTTTTTGAA. External right primer: GATCAACATCACTCCGACCC. Internal left primer: CCACCTTTAAAATTGGGCAG. Internal right primer: GTGAAAAAGATGACTACATCAAGAA. Internal WT amplicon: 1314 bp. Deletion size: 551 bp. Deletion left flank: CCCCTTCTTATCCATGATGTCTCTTGCTAT. Deletion right flank: GCACAATGTTATATGATTGGAGATGCTGAA."

Proper citation: RRID:WB-STRAIN:WBStrain00037096 Copy   


  • RRID:WB-STRAIN:WBStrain00037094

http://www.wormbase.org/db/get?name=WBStrain00037094

Source Database: WormBase (WB)
Affected Genes: WBGene00006565(tfg-1)|WBGene00006829(unc-101)
Genomic Alteration: WBGene00006565(tfg-1), WBGene00006829(unc-101)
Availability: available
Source References: EMPTY
Synonyms: tfg-1(ok2290)/hIn1 [unc-101(sy241)] I.
Alternate IDs: WB-STRAIN:VC2125, CGC_VC2125
Notes: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"Y63D3A.5. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok2290 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AGCTCCGGATAAACTTGGGT. External right primer: TATTCCCTTCCCACCAATCA. Internal left primer: TTCCAGATGGTGCATTCAAA. Internal right primer: AGACAGGAGCCCGAGATTTT. Internal WT amplicon: 2440 bp. Deletion size: 1264 bp. Deletion left flank: AGCAGATTAAGGTAAGGAGGATTTTGAGCG. Deletion right flank: CCACCACCGCAGGGAGCTCCCCAGCAAGGA."

Proper citation: RRID:WB-STRAIN:WBStrain00037094 Copy   


  • RRID:WB-STRAIN:WBStrain00037098

http://www.wormbase.org/db/get?name=WBStrain00037098

Source Database: WormBase (WB)
Affected Genes: WBGene00022043(psf-3)
Genomic Alteration: WBGene00022043(psf-3)
Availability: available
Source References: EMPTY
Synonyms: Y65B4BR.8(ok2828) I.
Alternate IDs: WB-STRAIN:VC2130, CGC_VC2130
Notes: Made_by: Vancouver KO Group|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y65B4BR.8. External left primer: TAAAGGCGCACACATTTTCA. External right primer: GTTTTTGCAGCAGCCTTTTC. Internal left primer: AAAATTTGTCGTGCCGAGAT. Internal right primer: TTACAGAATGGTGGGTTTGAA. Internal WT amplicon: 1278 bp. Deletion size: 465 bp. Deletion left flank: AATCGTTCCAATTGTTTCCAGGTAATGGCT. Deletion right flank: TCGCACGATGCCTTGTCTCCACACTTACAC."

Proper citation: RRID:WB-STRAIN:WBStrain00037098 Copy   


  • RRID:WB-STRAIN:WBStrain00037091

http://www.wormbase.org/db/get?name=WBStrain00037091

Source Database: WormBase (WB)
Affected Genes: WBGene00001732(grl-23)
Genomic Alteration: WBGene00001732(grl-23)
Availability: available
Source References: EMPTY
Synonyms: grl-23(ok2849) V.
Alternate IDs: WB-STRAIN:VC2122, CGC_VC2122
Notes: E02A10.2. External left primer: TCGACCTTCTCGCTCTTTTC. External right primer: GAGGAGGAGGTGGAGGATGT. Internal left primer: CGACCTCATCTTCCTTCTTTTC. Internal right primer: CGCCAGTTAAGATGGTTTGG. Internal WT amplicon: 1228 bp. Deletion size: 583 bp. Deletion left flank: CTTGCGTCCACATCCACCACCGCATCCTCC. Deletion right flank: ACCTCCTCCTCCACCTGTAAATCAAATAAT.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037091 Copy   


  • RRID:WB-STRAIN:WBStrain00037092

http://www.wormbase.org/db/get?name=WBStrain00037092

Source Database: WormBase (WB)
Affected Genes: WBGene00005526(sri-14)
Genomic Alteration: WBGene00005526(sri-14)
Availability: available
Source References: PMID:34429473, PMID:38514005
Synonyms: sri-14(ok2865) I
Alternate IDs: WB-STRAIN:VC2123, CGC_VC2123
Notes: M01G12.1. External left primer: CTGCTGCGTTTTTCGTATCA. External right primer: AAGAGCGAATGGATTTGGTG. Internal left primer: TCAGTCTGATCATTTTTCCTTCAA. Internal right primer: TGATTGGTCGGTCATTCAAA. Internal WT amplicon: 1166 bp. Deletion size: 532 bp. Deletion left flank: ACGTCGATTGCTTTTTGACTTCGCAGAAAT. Deletion right flank: ACAAAGTGGCACAACTATAAAAACGCCAGGAAGCACTATTTGCATGACTAAC.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"WBStrain provided so WBPaper00061836 paper added based on AFP_Strain data."

Proper citation: RRID:WB-STRAIN:WBStrain00037092 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X