Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
VC2107 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037080 | Caenorhabditis elegans | grd-12(ok2677) V. | F02D8.2. External left primer: ATCAATGTCCGCCAGCTTAC. External right primer: ATGTCCATCATGCACTCCAA. Internal left primer: CGGAATTATAATCCTCCGCA. Internal right primer: AGCCGGATACATTTGAGTTCT. Internal WT amplicon: 1104 bp. Deletion size: 597 bp. Deletion left flank: TCATATGCTATGCCAAAATACGCAGTTGCT. Deletion right flank: GGAAAGGTATTATTCACATATCTACTTATC. Insertion Sequence: TCCCAATATGCAATGGTTCCATATCCAA.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00001701(grd-12) | WBGene00001701(grd-12) | WB-STRAIN:WBStrain00037080 | WormBase (WB) | WB | available | WB-STRAIN:VC2107, CGC_VC2107 | 2026-08-29 09:23:18 | 0 | |||
|
VC2046 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037049 | Caenorhabditis elegans | acs-13(ok2815) I. | Made_by: Vancouver KO Group|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y65B4BL.5. External left primer: TATTCGGCTTTGAGGAGAGC. External right primer: AAAGGCCACTGGTGAGTTTG. Internal left primer: TGAACAAATGATTGAGCGACA. Internal right primer: ACCGATGAGCTCAAAACGAC. Internal WT amplicon: 1131 bp. Deletion size: 603 bp. Deletion left flank: GGATCACCATTCCGACGTGTCCGGCTAGCG. Deletion right flank: TGAGTGAGCATCACACCTTTCGGTGTTCCA. [NOTE: ok2861 has been found to be same molecular lesion as ok2815. These alleles are likely two isolates of the same deletion pulled from the screening pool.]" | WBGene00022037(acs-13) | WBGene00022037(acs-13) | WB-STRAIN:WBStrain00037049 | WormBase (WB) | WB | available | WB-STRAIN:VC2046, CGC_VC2046 | 2026-08-29 09:23:16 | 0 | |||
|
VC2037 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037046 | Caenorhabditis elegans | C46F11.3(gk1070) III. | C46F11.3. External left primer: AGCAAAAGAATTGGCGAAGA. External right primer: CGATACCTCCAGATCCTCCA. Internal left primer: TATCACCAGGTGTGCATTGG. Internal right primer: AACTCCTTGACGCCAGACAT. Internal WT amplicon: 1888 bp. Deletion size: 971 bp. Deletion left flank: AAATCAGGCGTTGATCCCATAGGACTAAAA. Deletion right flank: TTTTAAACTCTTCGCGCGCTGAAAAAGGGG.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00008118(madf-8) | WBGene00008118(madf-8) | WB-STRAIN:WBStrain00037046 | WormBase (WB) | WB | available | WB-STRAIN:VC2037, CGC_VC2037 | 2026-08-29 09:23:16 | 0 | |||
|
VC2048 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037051 | Caenorhabditis elegans | F09E10.6(ok2817) X. | F09E10.6. External left primer: GCCACCTGCCGAGTTATTTA. External right primer: CAATTTCCTGCCATTCCTGT. Internal left primer: CGCCATGAGGTGTTTACTGA. Internal right primer: GCTACTCCCCCACCAAAAGT. Internal WT amplicon: 1115 bp. Deletion size: 635 bp. Deletion left flank: GCAGAACCCGATAGATGTCGGGCCATAGTA. Deletion right flank: AGTTTTCAGGGCCTGTTGCCTGCCTACTTC. Insertion Sequence: ACAA.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00017296(F09E10.6) | WBGene00017296(F09E10.6) | WB-STRAIN:WBStrain00037051 | WormBase (WB) | WB | available | WB-STRAIN:VC2048, CGC_VC2048 | 2026-08-29 09:23:15 | 0 | |||
|
VC2049 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037052 | Caenorhabditis elegans | Y48A6C.1(gk955) III. | Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y48A6C.1. External left primer: GGGTTTTCAGCCATTTTTCA. External right primer: AATTTCAATCAGAAACGCGG. Internal left primer: TTGTATCGATTAATCCCGGC. Internal right primer: TTTCGTCCGAACCGTTAGTC. Internal WT amplicon: 2443 bp. Deletion size: 1549 bp. Deletion left flank: CCATTTTTCAGCAAAAATGCACTGACTCTG. Deletion right flank: CGTAAATTTTTTCGGGTTTTTAAACTCCAA." | WBGene00012974(Y48A6C.1) | WBGene00012974(Y48A6C.1) | WB-STRAIN:WBStrain00037052 | WormBase (WB) | WB | available | WB-STRAIN:VC2049, CGC_VC2049 | 2026-08-29 09:23:16 | 0 | |||
|
VC2047 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037050 | Caenorhabditis elegans | F09E10.6(ok2816) X. | F09E10.6. External left primer: GCCACCTGCCGAGTTATTTA. External right primer: CAATTTCCTGCCATTCCTGT. Internal left primer: CGCCATGAGGTGTTTACTGA. Internal right primer: GCTACTCCCCCACCAAAAGT. Internal WT amplicon: 1115 bp. Deletion size: 398 bp. Deletion left flank: GAGGTTATTGAAAAAAAAATAAAGCAACAA. Deletion right flank: GCTTGGTGTTAACACCACATAGTGCGAAAG.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00017296(F09E10.6) | WBGene00017296(F09E10.6) | WB-STRAIN:WBStrain00037050 | WormBase (WB) | WB | available | WB-STRAIN:VC2047, CGC_VC2047 | 2026-08-29 09:23:17 | 0 | |||
|
VC2052 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037055 | Caenorhabditis elegans | Y116A8C.19(gk958) IV. | Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y116A8C.19. External left primer: GAAAAGCTCAATTTTTGCCG. External right primer: TCGCCTTCTTTTTACAGCGT. Internal left primer: CGACGTGCTATCGAACTTGA. Internal right primer: CTCCGGAATCTAGCAACCAA. Internal WT amplicon: 957 bp. Deletion size: 210 bp. Deletion left flank: CAAAGAACTGTTTTATAGTTACGATGAGTT. Deletion right flank: GAAAACTGATCTCCGTCATAAGATCCTGGA." | WBGene00013796(Y116A8C.19) | WBGene00013796(Y116A8C.19) | WB-STRAIN:WBStrain00037055 | WormBase (WB) | WB | available | WB-STRAIN:VC2052, CGC_VC2052 | 2026-08-29 09:23:16 | 0 | |||
|
VC2053 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00037056 | Caenorhabditis elegans | wip-1(ok2435) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). | R144.4. Homozygous sterile or near-sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2435 homozygotes (grotty, Unc, with vulval blip). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AACGTATTCCGAAGTGCGAC. External right primer: CCATGAAGAAACCCAGGAAA. Internal left primer: TCAGAAAGATTGTTCCGGTTTT. Internal right primer: GGGGGATTGACGGACTATTT. Internal WT amplicon: 3053 bp. Deletion size: 1544 bp. Deletion left flank: AAATAAGACGGTAAAGAATTTTATCAGAAT. Deletion right flank: TCAGTTCCAAGCTCAAAACCGACTCCACCT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00000254(bli-4)|WBGene00020094(wip-1) | WBGene00000254(bli-4), WBGene00020094(wip-1) | WB-STRAIN:WBStrain00037056 | WormBase (WB) | WB | available | WB-STRAIN:VC2053, CGC_VC2053 | 2026-08-29 09:23:17 | 1 | |||
|
VC2050 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037053 | Caenorhabditis elegans | T08G5.7(gk956) V. | Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"T08G5.7. External left primer: CATCGCCTCAATCAGTCAAA. External right primer: TGTTGCCCCCTAATTTGTTG. Internal left primer: TTTCTTGCCTCCCTCTTGAA. Internal right primer: CAGTTTCCGTTTCGAAGCTC. Internal WT amplicon: 1279 bp. Deletion size: 581 bp. Deletion left flank: CAATCGTGTCACCTTATCATTCACATTTCT. Deletion right flank: GGCTGAAGTTGATCAATTCCGAATTCAGAG."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00011626(T08G5.7) | WBGene00011626(T08G5.7) | WB-STRAIN:WBStrain00037053 | WormBase (WB) | WB | available | WB-STRAIN:VC2050, CGC_VC2050 | 2026-08-29 09:23:17 | 0 | |||
|
VC2051 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037054 | Caenorhabditis elegans | nhr-185(gk957) V. | F47C10.1. External left primer: TCATTCTGGCAGGAAATTCA. External right primer: GGCGTAACGAAGTCCGATAA. Internal left primer: TCCGGTTAGTCCTGCAATTC. Internal right primer: CTGCTACCCATGTCGAGTGA. Internal WT amplicon: 2231 bp. Deletion size: 847 bp. Deletion left flank: AGCTGAGCCCGGTAGATGTCGGACCACTAA. Deletion right flank: GAGGTATAAATAAAAGTCTATAAGAAAGAC.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00018539(nhr-185) | WBGene00018539(nhr-185) | WB-STRAIN:WBStrain00037054 | WormBase (WB) | WB | available | WB-STRAIN:VC2051, CGC_VC2051 | 2026-08-29 09:23:15 | 0 | |||
|
VC2067 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037059 | Caenorhabditis elegans | C43H6.7(gk985) X. | C43H6.7. External left primer: ATCTTCATATTTGACCGGCG. External right primer: TCCATTCTGCTTCGTCACTG. Internal left primer: ACCATCACCAGAAGAATGCC. Internal right primer: GGTCAAAGCTGCGAACTCAT. Internal WT amplicon: 2524 bp. Deletion size: 438 bp. Deletion left flank: GCTTTGTAGTAATGATATTGGATGTTGAAT. Deletion right flank: TTTTCGTAATTACTACAGTGTTCTCAAAAT.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00016620(dhhc-9) | WBGene00016620(dhhc-9) | WB-STRAIN:WBStrain00037059 | WormBase (WB) | WB | available | WB-STRAIN:VC2067, CGC_VC2067 | 2026-08-29 09:23:17 | 0 | |||
|
VC2063 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037058 | Caenorhabditis elegans | Y17G7B.22(gk1012) II. | Made_by: Vancouver KO Group|"Mutagen: Formaldehyde"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y17G7B.22. External left primer: CCCGTAGTTCATCGATTGCT. External right primer: AAAAAGAATACCACCGGCCT. Internal left primer: ATCTGTTGCCTTCTGTTGGG. Internal right primer: TCGCAGGAGTTTGGGTACTT. Internal WT amplicon: 2119 bp. Deletion size: 1795 bp. Deletion left flank: AAAGACGAAATTGAGAAGAAAATTGCTGAG. Deletion right flank: TTTTGGTGCTTCAAAAAACATCAAAAAATA. Insertion Sequence: AAAATTTGATACTTTTTGATGTT." | WBGene00012473(Y17G7B.22) | WBGene00012473(Y17G7B.22) | WB-STRAIN:WBStrain00037058 | WormBase (WB) | WB | available | WB-STRAIN:VC2063, CGC_VC2063 | 2026-08-29 09:23:16 | 0 | |||
|
VC2071 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037062 | Caenorhabditis elegans | F39B2.1(gk3174) I. | Made_by: Vancouver KO Group|"This strain is homozygous for a deletion (gk3174) in F39B2.1, detectable by PCR using the following primers. External left primer: CCGGTAGTAGCTTTCCCCTC. External right primer: AAGTCGCATAAGTCCATCGG. Internal left primer: ATATCAACCATCCAGCCAGC. Internal right primer: CGTCAGAATGGTACACAGCG. Internal WT amplicon: 2358 bp. Deletion size: approximately 450 bp. Validation: gk3174 passed by CGH. Left deleted probe: CATGGTCGCGACGAGGCTCAATCTGATCCATCACGCCAACTTTTGTTTAA. Right deleted probe: GATAGAATTCAACAGAATTTTTCGAGTGAGTAAGGATTTCTGGACAGTGA."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00009553(hinf-1) | WBGene00009553(hinf-1) | WB-STRAIN:WBStrain00037062 | WormBase (WB) | WB | available | WB-STRAIN:VC2071, CGC_VC2071 | 2026-08-29 09:23:17 | 0 | |||
|
VC2072 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037063 | Caenorhabditis elegans | grh-1(gk960) I. | Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y48G8AR.1. External left primer: GTTTTCCTAAAGTTCGGCCC. External right primer: CCCTTTCACTTTTCACCGAA. Internal left primer: CATAAGCTCGATCCCAAAGC. Internal right primer: CTTTGAATCGCGGAATTTGT. Internal WT amplicon: 3012 bp. Deletion size: 786 bp. Deletion left flank: CAATGTCGATTGGCTCGTTTTTGAATTCTA. Deletion right flank: AATAGTTAAAGTCCAATTCATTGTTTATTA." | WBGene00001707(grh-1) | WBGene00001707(grh-1) | WB-STRAIN:WBStrain00037063 | WormBase (WB) | WB | available | WB-STRAIN:VC2072, CGC_VC2072 | 2026-08-29 09:23:15 | 0 | |||
|
VC2069 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037061 | Caenorhabditis elegans | Y116A8C.20(gk913) IV. | Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y116A8C.20. External left primer: ACGCTGTAAAAAGAAGGCGA. External right primer: TGAGCACGTTTTTGAAATGC. Internal left primer: AGCGGCTGAAGAGAAGTTTG. Internal right primer: GACTGACGCAGTGACAGGAA. Internal WT amplicon: 1414 bp. Deletion size: 378 bp. Deletion left flank: ATGGGCGGAGCTTCCCGATCAATAATTGAC. Deletion right flank: CAATTACCCTCCATCCCTTTCACATACATC." | WBGene00013797(Y116A8C.20) | WBGene00013797(Y116A8C.20) | WB-STRAIN:WBStrain00037061 | WormBase (WB) | WB | available | WB-STRAIN:VC2069, CGC_VC2069 | 2026-08-29 09:23:16 | 0 | |||
|
VC2081 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037066 | Caenorhabditis elegans | T26A8.4(gk917) IV/nT1 [qIs51] (IV;V). | T26A8.4. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk917 homozygotes (Dpyish, late larval arrest or sterile adult). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGCTTTGGCTCTTCTTGGAT. External right primer: TGTTTGCGCTGAGAGAGAGA. Internal left primer: GCTGAACTAATCCAGGCTGC. Internal right primer: TCCAACGTTCAAGATTCCAA. Internal WT amplicon: 1977 bp. Deletion size: 722 bp. Deletion left flank: TAATTATTATGGAAAAGTGATTTCGATTTT. Deletion right flank: AATTATTCCCATTTATTAATGCGTCAATAA. Insertion Sequence: TTGCTTACCTCCAGGGAGG.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00020827(T26A8.4) | WBGene00020827(T26A8.4) | WB-STRAIN:WBStrain00037066 | WormBase (WB) | WB | available | WB-STRAIN:VC2081, CGC_VC2081 | 2026-08-29 09:23:15 | 0 | |||
|
VC2082 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037067 | Caenorhabditis elegans | srab-2(gk686) V/nT1 [qIs51] (IV;V). | C04F5.5. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk686 homozygotes (embryonic or early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AGTCAGACCCGCTTTGAGAA. External right primer: CAAACATGGTGCAAGACCAG. Internal left primer: CGAAGAATGCTTGCAAATGA. Internal right primer: TCCTTCGAGCCAGCTGTATT. Internal WT amplicon: 2299 bp. Deletion size: 1150 bp. Deletion left flank: AAGAAACTCTTTTGAGTTACCTCATTTTTT. Deletion right flank: TTTCTCCACGCTACTCCGACACATTATCAC.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00015447(srab-2) | WBGene00015447(srab-2) | WB-STRAIN:WBStrain00037067 | WormBase (WB) | WB | available | WB-STRAIN:VC2082, CGC_VC2082 | 2026-08-29 09:23:16 | 0 | |||
|
VC2074 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037065 | Caenorhabditis elegans | C39D10.7(ok2758) X. | C39D10.7. External left primer: TTTGCATGTATCCACGGTGT. External right primer: TAAGCAGCGGAAACCATTTT. Internal left primer: GGGGCACATGAGGAAATAAG. Internal right primer: TTTCAAACAAAAATTCCCCC. Internal WT amplicon: 1179 bp. Deletion size: 691 bp. Deletion left flank: CAGATAACTTGTGATTTTGCACAGTCTAAC. Deletion right flank: TAGAGTTGTTGTGAAGATTGTTGATGTGTA.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00016534(C39D10.7) | WBGene00016534(C39D10.7) | WB-STRAIN:WBStrain00037065 | WormBase (WB) | WB | available | WB-STRAIN:VC2074, CGC_VC2074 | 2026-08-29 09:23:17 | 0 | |||
|
VC2000 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037024 | Caenorhabditis elegans | mca-1(ok2532) IV/nT1 [qIs51] (IV;V). | This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"W09C2.3. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2532 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AGGTTAGAAGCTGACGAGCG. External right primer: TGAATCCGATCCAGTTCTCC. Internal left primer: CAGTCGGCAGATTTCACAGA. Internal right primer: CCGGAAAAATGCTCATCACT. Internal WT amplicon: 3166 bp. Deletion size: 1418 bp. Deletion left flank: TCGCGGATTCTCTCATTGAATTCCTTTCCT. Deletion right flank: ACTTTTCCATTTTCGTCGCGGATTCTCTCA." | WBGene00003151(mca-1) | WBGene00003151(mca-1) | WB-STRAIN:WBStrain00037024 | WormBase (WB) | WB | available | WB-STRAIN:VC2000, CGC_VC2000 | 2026-08-29 09:23:14 | 0 | |||
|
VC2006 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037028 | Caenorhabditis elegans | K09A11.1(gk1064) X. | K09A11.1. Identified by PCR, validated by CGH. External left primer: GAGCAACGAAATTTTGGGAA. External right primer: GTTATGTTTGCCGCGAGATT. Internal left primer: GGAGTATCCGTCCGCAATAG. Internal right primer: TGCAGCTCTCTTTCCATGTG. Internal WT amplicon: 2161 bp. Deletion size: 810 bp. Deletion left flank: TTTGTTCTCCACTCTTTATTCGTATTGAAT. Deletion right flank: GTACGAAGACCAACTAAGAATGGAATTGAA. Insertion Sequence: CTTATTTC.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00010704(K09A11.1) | WBGene00010704(K09A11.1) | WB-STRAIN:WBStrain00037028 | WormBase (WB) | WB | available | WB-STRAIN:VC2006, CGC_VC2006 | 2026-08-29 09:23:15 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
