Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
ACI-Pvt1em5Shul/Rrrc Resource Report Resource Website |
RRID:RGD_150520217 | Rattus norvegicus | Using CRISPR/Cas9, a suspected enhancer of miR1208 was deleted in a 8315bp excision in ACI rat embryos. This strain is maintained at Rat Resource and Research Center. | 150520217 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 150520217 | 2026-09-05 06:52:41 | 0 | |||||
|
SD-Add3em1Mcwi/ Roman Resource Report Resource Website |
RRID:RGD_150429615 | Rattus norvegicus | ZFN system was used to Knock out the rat Add3 gene of Crl:SD rat embryos.The ZFN mRNA was injected into the pronucleus of fertilized SpragueDawley embryos and transferred to the oviduct of pseudopregnant females. PCR genotyping of tail biopsies confirmed a 14-bp deletion using forward primer 5'-GCCCCCATGAGTCACTACAC-3' and reverse primer 5'-GCTACAGGAAGCATCTCCTGTG-3'. Founders with Add3 deletion were backcrossed to the parental strain to generate heterozygous F1 rats. Heterozygous F1 siblings were then intercrossed to derive a homozygous KO line used | 150429615 | mutant | Rat Genome Database (RGD) | RGD | Unknown (as of 2021-09-09) | 150429615 | 2026-09-05 06:52:41 | 0 | |||||
|
BBDR.BBDP-(D4Mit6-D4Mit7)-Tlr4em5Mcwi Resource Report Resource Website |
RRID:RGD_14394508 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a 5-bp deletion in exon2 in the Tlr4 gene of BBDR.BBDP-(D4Mit6-D4Mit7)/RhwMcwi embryos. Contact MCW rat distribution at [email protected] | 14394508 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2019-03-25) | 14394508 | 2026-09-05 06:52:41 | 0 | |||||
|
SHRSP-Stim1em1Izm Resource Report Resource Website |
RRID:RGD_39128170 | Rattus norvegicus | "This strain was generated by co-introducing fertilized eggs of SHRSP/Izm with the guide RNA/Cas9 nuclease expression plasmid and ssODN, which targets the Stim1 gene, at the Institute of Laboratory Animals, Graduate School of Medicine, Kyoto University. SHRSP/Izm strain has a nonsense mutation (c.1918C>T, p.Arg640X) in the Stim1 gene, but homologous recombination with the introduced ssODN replaces this mutation with a normal sequence. The sequence of the guide RNA target site is as follows, Stim1: 5'-GCAGGGTAGCTGAAACACAC-3' The sequence of the ssODN for homologous recombination is as follows, 5'-ATAGCCTTCTTGCCAGCCAAGTGGGGAATTCGTGTGTTTCGGCTACCCTGCAGGGCTCGGCTGTCCCCAACTGGAGATGGCCATCTCCAGTTGGGGACAGCCGAGCCCTGCAGGGTAGCCGAAACACACGAATTCCCCACTTGGCTGGCAAGAAGGCTAT-3'" National BioResource Project for the Rat in Japan | 39128170 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2020-09-23) | 39128170 | 2026-09-05 06:52:41 | 0 | |||||
|
LE-Tg(Pvalb-cre)2-28Koba Resource Report Resource Website |
RRID:RGD_39128171 | Rattus norvegicus | This strain is established by injection of modified BAC (cre gene was inserted into the exon 2 of mouse Pvalb gene) into Long-Evans rat's fertile eggs. National BioResource Project for the Rat in Japan | 39128171 | mutant | Rat Genome Database (RGD) | RGD | Live Animals; Cryopreserved Sperm (as of 2020-09-23) | 39128171 | 2026-09-05 06:52:41 | 0 | |||||
|
SD-Bckdkm1Dbsa Resource Report Resource Website |
RRID:RGD_39457947 | Rattus norvegicus | The frogleg phenotype arose in a breeding colony of Sprague-Dawley rats which had originated with animals purchased from Taconic Farms (Hamilton, NY). The frogleg rats, which require no special husbandry, were bred and maintained at Spring Valley Laboratories, Inc (Woodbine,MD). The complex phenotype seen in the frogleg rat arises from a missense mutation (p.G369E) in the gene Bckdk. | 39457947 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 39457947 | 2026-09-05 06:52:42 | 0 | |||||
|
SD.BN-Aireem1Ang-/- Resource Report Resource Website |
RRID:RGD_38599147 | Rattus norvegicus | The BN homozygous Aire mutant rats were derived from founder rats that were backcrossed in a Sprague Dawley (SD; outbred strain) background for six generations to obtain AIRE-deficient SD rats. The original founder were from BN mutants carrying the mutations created by ZFN reagents targeting to a DNA sequence 59-TGCCACCCAGACCCCCCACAAAGAGAAGAGCCCTGGAAGAG- 39 in exon 3 of the Aire gene. This mutant carriesa 17-bp deletion in the nuclear localization signal sequence, causing a premature stop codon. | 38599147 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 38599147 | 2026-09-05 06:52:42 | 0 | |||||
|
SD-Rag1/Rag2em1Mlit Resource Report Resource Website |
RRID:RGD_38548914 | Rattus norvegicus | The Rag1, Rag2 double-knock rats were obtained by injecting the mixture of Rag1- and Rag2-targeting sgRNA into 1-cell embryo. The resulted mutations were a 1564-bp deletion in Rag1 and 85-bp deletion in Rag2. | 38548914 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 38548914 | 2026-09-05 06:52:42 | 0 | |||||
|
SD-Rag1/Rag2em1MlitIl2rgem1Mlit-/y Resource Report Resource Website |
RRID:RGD_38548916 | Rattus norvegicus | The Rag1, Rag2, and Il2rg triple-knockout rats were obtained by intercrossing Rag1 and Rag2 double-knockout rat (RGD:38548914) with Il2rg knockout rat (RGD:38548915). | 38548916 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 38548916 | 2026-09-05 06:52:42 | 0 | |||||
|
SS-Rictorem4Mcwi Resource Report Resource Website |
RRID:RGD_25330091 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a 11-bp deletion in exon 19 of rat Rictor gene. Contact MCW rat distribution at [email protected] | 25330091 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2021-11-03) | 25330091 | 2026-09-05 06:52:42 | 0 | |||||
|
LE-Dyrk1aem3Mcwi Resource Report Resource Website |
RRID:RGD_25394526 | Rattus norvegicus | The rat strain was produced by injecting CRISPR/Cas9 targeting rat Dyrk1a into Crl:LE embryos. The result is a 5-bp deletion in exon 3 of the gene. Autism Rat Model Resource. Contact MCW rat distribution at [email protected] | 25394526 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 25394526 | 2026-09-05 06:52:42 | 0 | |||||
|
SD-Cyp2c11em1Nju Resource Report Resource Website |
RRID:RGD_150429707 | Rattus norvegicus | CRISPR/Cas9 system containing two pairs of single guide RNA (sgRNA) primers: sgRNA1 (forward primer: 59-GCTACTG- TAACTGACATGTT-39; reverse primer: 59-AACATGTCAGTTACAGTAGC- 39) and sgRNA2 (forward primer: 59-TCAAGGGTAAACTCAGACTG-39; reverse primer: 59-CAGTCTGAGTTTACCCTTGA-39), was injected to Sprague-Dawley rat one-cell embryos. The F0 pups were screened by genomic DNA sequencing to identify heterozygous CYP2C11+/2 founders.This mutant strain carries a two base pairs (GT) insertion into exon 6 of CYP2C11 and resulting in the knockout allele. | 150429707 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 150429707 | 2026-09-05 06:52:42 | 0 | |||||
|
SS-Kcnj2em2Mcwi Resource Report Resource Website |
RRID:RGD_14394494 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a 28-bp deletion mutation in exon 1 of the Kcnj2 gene of SS/JrHsdMcwi rat embryos. Contact MCW rat distribution at [email protected] | 14394494 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2019-03-22) | 14394494 | 2026-09-05 06:52:42 | 0 | |||||
|
LE-Cyfip1em1Sage+/- Resource Report Resource Website |
RRID:RGD_14985210 | Rattus norvegicus | The bioinformatics software (Horizon Discovery, St. Louis, USA) was used to design a short guide RNA (sgRNA) targeting a Protospacer Adjacent Motif (PAM) sequence within exon 7 of the rat Cyfip1gene (GGCAGATCCACAATCCATCCagg) on chromosome 1 (first 21 of 32 exons, Refseq: NC_005100.4, NM_001107517.1).sgRNA-Cas9 was performed by nucleofecting the sgRNA-Cas9 into rat C6 glial cells. Genomic DNA (gDNA) PCR products were subsequently generated from nucleofected C6 cells using primers flanking the sgRNA site (FOR: GCCAAAGCTTCCCCTAAAGT; REV: TGGGCGTCAAGTACATTCTG; 497bp amplicon). Embryos were collected from donor female Long Evans rats and injected with the validated sgRNA-Cas9. Then implanted into synchronized pseudopregnant Long Evans recipient female This mutant carries 4bp out of frame heterozygous deletion in exon 7 of the Cyfip1, resulting bioinformatics prediction of an early stop codon in exon 8. | 14985210 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 14985210 | 2026-09-05 06:52:42 | 0 | |||||
|
SD-Dnmt1tm1(Myh6-cre)Cqin Resource Report Resource Website 1+ mentions |
RRID:RGD_126925139 | Rattus norvegicus | To specifically knockout Dnmt1 in the myocardium, Cre-loxP system was used by crossing alpha -MHC-Cre rats with Dnmt1 cKO rats. Dnmt1+/- offspring positive for the alpha MHC-Cre transgene (double-positive) were selected. In the second round of crossbreeding, the double-positive rats were crossed with Dnmt1 cKO rats, and Dnmt1-/- offspring positive for the alpha MHC-Cre transgene were obtained as myocardium-specific Dnmt1-KO rats | 126925139 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 126925139 | 2026-09-05 06:52:42 | 1 | |||||
|
F344-Atg16l1em8Rrrc Resource Report Resource Website 1+ mentions |
RRID:RGD_149735570 | Rattus norvegicus | CRISPR-Cas9-mediated knock-in of a single base pair polymorphism of guanine to alanine in exon 10, resulting in a threonine to alanine substitution at amino acid position 299 in the rat. Mimics the same nucleotide substitution for the threonine to alanine substitution at amino acid position 300 in humans (T300A), Homozygosity for this allele is embryonic lethal. RRRC | 149735570 | mutant | Rat Genome Database (RGD) | RGD | Live Animals (as of 2021-07-23) | 149735570 | 2026-09-05 06:52:42 | 1 | |||||
|
SD-Lrp5em3Vari Resource Report Resource Website |
RRID:RGD_41404651 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce an inversion coupled with small deletions in the exon 2 at both the sgRNA1 (11 bp) and sgRNA2 sites (3 bp) in the rat Lrp5 gene of Crl:SD embryos. | 41404651 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 41404651 | 2026-09-05 06:52:42 | 0 | |||||
|
WI.SD-PcloTn(sb-B-Geo)Fkh Resource Report Resource Website |
RRID:RGD_41408339 | Rattus norvegicus | The Sprague-Dawley transposon mutagenesis spermatogonial gene trap library was screen to generate rats with a disrupted Pclo gene in Wistar rat background. The transposon element was integrated into exon 3 of the Pclo genomic sequence, leading to a premature stop in the reading frame. | 41408339 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 41408339 | 2026-09-05 06:52:41 | 0 | |||||
|
W-Phf24em24Iexas Resource Report Resource Website |
RRID:RGD_38676452 | Rattus norvegicus | This strain was establishe by CRISPR-Cas9 system at Osaka University. Target sequence is CCATGGGGGTGTTGATGTCCAAG (CCA is PAM sequence). Back ground strain is Crlj:Wistar (WI). This strain is line No. 24 and has a 141-bp deletion in Phf24 gene. Off-target effects (214 candidate region) have not yet been examined. National BioResource Project for the Rat in Japan | 38676452 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2020-09-17) | 38676452 | 2026-09-05 06:52:42 | 0 | |||||
|
F344; W-Phf24em6(EGFP)Iexas Resource Report Resource Website |
RRID:RGD_38676453 | Rattus norvegicus | This strain (line No. 6) was establishe by CRISPR-Cas9 system at Osaka University and EGFP sequence was knock-in in Phf24 gene. Back ground strain is Crlj:Wistar (WI). Founder rats were crossed with F344/NSlc, and this strain was maintained by crossing with F344/NSlc (F2 or F3 generation, November 2017). At the point of sperm cryopreservation, this strain is not "congenic" strain (backcross generation was <5 generations), but background is mix of Crlj:Wistar and F344/NSlc. National BioResource Project for the Rat in Japan | 38676453 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2020-09-17) | 38676453 | 2026-09-05 06:52:42 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.