Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes
Norway

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search
Reset search
On page 15 showing 281 ~ 300 out of 122,918 results
Snippet view Table view Download Top 1000 Results

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

    • RRID:WB-STRAIN:WBStrain00051072

http://www.wormbase.org/db/get?name=WBStrain00051072

Source Database: WormBase (WB)
Affected Genes: WBGene00008117(gsr-1)
Genomic Alteration: WBGene00008117(gsr-1)
Availability: unknown
Source References: EMPTY
Synonyms: gsr-1(xu413) III.
Notes: gsr-1(xu413) is a S21F missense mutation; suppresses LITE-1 function. Reference: Zhang W, et al. PLOS Genetics 2020 Dec 10;16(12):e1009257. PMID: 33301443|"Made_by: Wenyuan Zhang"

Proper citation: RRID:WB-STRAIN:WBStrain00051072 Copy   

    • RRID:WB-STRAIN:WBStrain00051071

http://www.wormbase.org/db/get?name=WBStrain00051071

Source Database: WormBase (WB)
Affected Genes: WBGene00007108(gspd-1)
Genomic Alteration: WBGene00007108(gspd-1)
Availability: unknown
Source References: EMPTY
Synonyms: gspd-1(xu409) IV.
Notes: gspd-1(xu409) is a L369F missense mutation; suppresses LITE-1 function. Reference: Zhang W, et al. PLOS Genetics 2020 Dec 10;16(12):e1009257. PMID: 33301443|"Made_by: Wenyuan Zhang"

Proper citation: RRID:WB-STRAIN:WBStrain00051071 Copy   

    • RRID:WB-STRAIN:WBStrain00051075

http://www.wormbase.org/db/get?name=WBStrain00051075

Source Database: WormBase (WB)
Affected Genes: WBGene00015553(trxr-1)
Genomic Alteration: WBGene00015553(trxr-1)
Availability: unknown
Source References: EMPTY
Synonyms: trxr-1(xu421) IV.
Notes: Made_by: Wenyuan Zhang|"trxr-1(xu421) is a W275* nonsense mutation; suppresses LITE-1 function. Reference: Zhang W, et al. PLOS Genetics 2020 Dec 10;16(12):e1009257. PMID: 33301443"

Proper citation: RRID:WB-STRAIN:WBStrain00051075 Copy   

http://www.wormbase.org/db/get?name=WBStrain00051115

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004234(ptr-20)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004234(ptr-20), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: ptr-20(gk5231[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ II.
Notes: Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 3301 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TGAAGCACTCGGTGAAGTTTCGCAGGCTCA. Right flanking sequence: TCGTACTAATGTCCCTTCTAGTGTTGGTAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00051115 Copy   

http://www.wormbase.org/db/get?name=WBStrain00051113

Source Database: WormBase (WB)
Affected Genes: WBGene00001745(gsa-1)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00001745(gsa-1), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: gsa-1(gk5168[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I.
Notes: Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2926 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TGATCCGATTGCGAACGTTCGATCCCCAAC. Right flanking sequence: CAAAGTCGACGTTGTGCGACAGAACAACTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00051113 Copy   

    • RRID:WB-STRAIN:WBStrain00051079

http://www.wormbase.org/db/get?name=WBStrain00051079

Source Database: WormBase (WB)
Affected Genes: WBGene00007009(wwp-1)
Genomic Alteration: WBGene00007009(wwp-1)
Availability: unknown
Source References: EMPTY
Synonyms: wwp-1(gk411) I.
Notes: Made_by: Vancouver KO Group|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y65B4BR.4a. gk411 is a 1455 bp deletion with a 532 bp insertion. Superficially wild type."

Proper citation: RRID:WB-STRAIN:WBStrain00051079 Copy   

http://www.wormbase.org/db/get?name=WBStrain00051119

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006375(syp-1)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006375(syp-1), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: syp-1(gk5282[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ V.
Notes: Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1616 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: ACTTCACAATTTGGGTTGACGCTCCCACTG. Right flanking sequence: CAGCCAAGTGTAGAAGTTACTCCAGTACAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00051119 Copy   

http://www.wormbase.org/db/get?name=WBStrain00051117

Source Database: WormBase (WB)
Affected Genes: WBGene00001580(gex-3)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00001580(gex-3), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: gex-3(gk5235[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ IV.
Notes: Made_by: Vancouver KO Group|"[NOTE: Please see RG5044 for balanced version of this strain.] Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2546 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: GTCGACGTTCGAATATGTACAAGAAAAGTC. Right flanking sequence: TGCTTCATCTGGTCATATGGTTTGGAGTGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."

Proper citation: RRID:WB-STRAIN:WBStrain00051117 Copy   

    • RRID:WB-STRAIN:WBStrain00051081

http://www.wormbase.org/db/get?name=WBStrain00051081

Source Database: WormBase (WB)
Affected Genes: WBGene00021813(Y53G8AR.6)
Genomic Alteration: WBGene00021813(Y53G8AR.6)
Availability: unknown
Source References: EMPTY
Synonyms: Y53G8AR.6(gk3515) III.
Notes: Homozygous viable, carrying a deletion in Y53G8AR.6. Please refer to supporting documents linked to the strain name in the CGC Strain Information display.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00051081 Copy   

    • RRID:WB-STRAIN:WBStrain00051080

http://www.wormbase.org/db/get?name=WBStrain00051080

Source Database: WormBase (WB)
Affected Genes: WBGene00019828(R02E12.4)
Genomic Alteration: WBGene00019828(R02E12.4)
Availability: unknown
Source References: EMPTY
Synonyms: R02E12.4(ok3304) X.
Notes: Homozygous viable, carrying a deletion in R02E12.4. Please refer to supporting documents linked to the strain name in the CGC Strain Information display.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00051080 Copy   

http://www.wormbase.org/db/get?name=WBStrain00051063

Source Database: WormBase (WB)
Affected Genes: WBGene00007640(pcmd-1)
Genomic Alteration: WBGene00007640(pcmd-1)
Availability: unknown
Source References: EMPTY
Synonyms: pcmd-1(syb486[gfp::pcmd-1]) I.
Notes: GFP tag inserted into endogenous pcmd-1 locus. Reference: Erpf AC, et al. Curr Biol. 2019 Apr 22;29(8):1324-1336.e6.doi: 10.1016/j.cub.2019.03.029. PMID: 30982652

Proper citation: RRID:WB-STRAIN:WBStrain00051063 Copy   

    • RRID:WB-STRAIN:WBStrain00051062

http://www.wormbase.org/db/get?name=WBStrain00051062

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: mikSi1 II; ltIs38.
Notes: Made_by: Anna Christina Erpf|"mikSi1 [sas-4p::dendra2::sas-4] inserted into ttTi5605 II. ltIs38 [pie-1p::GFP::PH(PLC1delta1) + unc-119(+)]. Photoconvertable tagged SAS-4 protein. Reference: Erpf AC & Mikeladze-Dvali T. (2020). Tracking of centriole inheritance in C. elegans. microPublication Biology. 10.17912/micropub.biology.000256."

Proper citation: RRID:WB-STRAIN:WBStrain00051062 Copy   

    • RRID:WB-STRAIN:WBStrain00051061

http://www.wormbase.org/db/get?name=WBStrain00051061

Source Database: WormBase (WB)
Affected Genes: WBGene00004879(smg-1)
Genomic Alteration: WBGene00004879(smg-1)
Availability: unknown
Source References: EMPTY
Synonyms: smg-1(gk761853) I.
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00051061 Copy   

    • RRID:WB-STRAIN:WBStrain00051067

http://www.wormbase.org/db/get?name=WBStrain00051067

Source Database: WormBase (WB)
Affected Genes: WBGene00001803(lite-1)
Genomic Alteration: WBGene00001803(lite-1)
Availability: unknown
Source References: EMPTY
Synonyms: lite-1(xu492) X.
Notes: Light sensation defect; loss of light sensation. lite-1(xu492) is a 2701 bp deletion generated by CRISPR/Cas9-based gene editing using the Fire Lab protocol (Arribere et al., 2014). Left flanking sequence: 5 CGTAAAAAACAACATGCCACCAC Right flanking sequence: 5' GGCGGCCACCTACGCCAGTA. Primer sequences used to detect the deletion: Forward (flanking): 5 GAAGAAAAGGCGGTGCAAAC; Reverse (flanking): 5 GAAGCAACAAGACGATCTCC; Forward (internal): 5 ATGATCGCAAAAATCCTGTCGAGTC. Wild-type product: 1972 bp; xu492 product: 1475 bp; both bands should be visible if heterozygous. Reference: Zhang W, et al. PLoS Genet. 2020 Dec 10;16(12):e1009257. doi: 10.1371/journal.pgen.1009257. eCollection 2020 Dec.

Proper citation: RRID:WB-STRAIN:WBStrain00051067 Copy   

http://www.wormbase.org/db/get?name=WBStrain00051100

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: C34D4.2(gk3801[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV.
Notes: Homozygous viable. Deletion of 800 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TAATTAGTCAGTATTTTTACTTGCCAGACG. Right flanking sequence: CGGACAAAGTTTTCTTGCTCCGAGGAAATC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00051100 Copy   

    • RRID:WB-STRAIN:WBStrain00051066

http://www.wormbase.org/db/get?name=WBStrain00051066

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: Y74C10AL.2(ogr3) I.
Notes: Short-lived at 25C. Sensitive to paraquat. ogr3 is a 1238 bp deletion; flanking sequences: aaaattttttaaaaaaatat - taaaatcttccaacaaaaaaa

Proper citation: RRID:WB-STRAIN:WBStrain00051066 Copy   

    • RRID:WB-STRAIN:WBStrain00051065

http://www.wormbase.org/db/get?name=WBStrain00051065

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: T09F3.2(ogr2) II.
Notes: Slow growth, Slow movement. T09F3.2 encodes a homolog of human mitochondrial pyrimidine nucleotide transporter. ogr2 is a 718 bp deletion; flanking sequences: gagtcggaagttctaattccaaatt - atcagtctaaatatcatttttcttctt

Proper citation: RRID:WB-STRAIN:WBStrain00051065 Copy   

http://www.wormbase.org/db/get?name=WBStrain00051102

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00019077(zipt-11)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00019077(zipt-11)
Availability: unknown
Source References: EMPTY
Synonyms: zipt-11(gk3833[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I.
Notes: Homozygous viable. Deletion of 1674 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: AATTTATCAGGCGCTTCTTGCGGCCACATT. Right flanking sequence: GGGTTAAACTCGGAAACTTGTTCACAACCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00051102 Copy   

http://www.wormbase.org/db/get?name=WBStrain00051101

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: eif-3.G(gk3804[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ II.
Notes: Made_by: Vancouver KO Group|"[NOTE: Please see RG5004 for balanced version of this strain.] Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 717 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TTTGTTATCCGATGGCCAAAAAATTCGCCT. Right flanking sequence: AATGATATCCGAATGTACCATATGGTTCTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."

Proper citation: RRID:WB-STRAIN:WBStrain00051101 Copy   

http://www.wormbase.org/db/get?name=WBStrain00051107

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: C30E1.9(gk3854[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X.
Notes: Homozygous viable. Deletion of 11852 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TGTTCCCTCACCCTTACTTTCGAATTCCCT. Right flanking sequence: TGGTTGTTTAATATGGTTATTCTTAAGGTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00051107 Copy   

Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X

  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X

About

The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.

Recent News Entries

NIH Data Sharing and Reuse Seminar- Sex Differences in Acute Kidney Injury Risk and Outcomes: Insights from MIMIC-III and MIMIC-IV

Join NIH's “It's About Time: Temporal Reasoning in Biomedical Knowledge Graphs Challenge”

dkNET community events and announcements in September, 2026

Contact Us

Email: info_at_ dknet.org

Stay Connected

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch