Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

On page 146 showing 2901 ~ 2920 out of 62,713 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.wormbase.org/db/get?name=WBStrain00055694

Source Database: WormBase (WB)
Affected Genes: WBGene00006784(unc-49)|WBGene00022675(gbb-2)
Genomic Alteration: WBGene00006784(unc-49), WBGene00022675(gbb-2)
Availability: unknown
Source References: EMPTY
Synonyms: unc-49(e407) III; gbb-2(tm1165) IV; hpIs592; ljIs131.
Notes: hpIs592 [ttr-39p::Chrimson::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Shrinker. Red fluorescence in D motor neurons. Reference: Lu Y, et al. 2022. Current Biology (In Press).

Proper citation: RRID:WB-STRAIN:WBStrain00055694 Copy   


  • RRID:WB-STRAIN:WBStrain00055699

http://www.wormbase.org/db/get?name=WBStrain00055699

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: hpIs596; hpIs268.
Notes: hpIs596 [acr-2(s)p::Chrimson::wCherry + lin-15(+)]. hpIs268 [unc-25p::GCaMP3si::SL2 wCherry + lin-15(+)]. Unc (linked to hpIs596). Green and red fluorescence in D-motor neurons. Very weak red fluorescence in A and B motorneurons. Reference: Lim MA, et al. eLife 2016;5:e19887. doi: 10.7554/eLife.19887. PMID: 27855782.

Proper citation: RRID:WB-STRAIN:WBStrain00055699 Copy   


  • RRID:WB-STRAIN:WBStrain00055732

http://www.wormbase.org/db/get?name=WBStrain00055732

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: hpIs615; hpIs365.
Notes: hpIs615 [acr-2(s)p::Arch::wCherry + lin-15(+)]. hpIs365 [unc-25p::GCaMP3::wCherry + lin-15(+)]. RFP expression in motor neurons. A and B motor neurons are inhibited and body relaxes upon illumination with green light. Reference: Lu Y, et al. 2022. Current Biology (In Press).

Proper citation: RRID:WB-STRAIN:WBStrain00055732 Copy   


http://www.wormbase.org/db/get?name=WBStrain00055735

Source Database: WormBase (WB)
Affected Genes: WBGene00017641(csr-1)
Genomic Alteration: WBGene00017641(csr-1)
Availability: unknown
Source References: EMPTY
Synonyms: fjSi1 II; csr-1(fj54) IV.
Notes: fjSi1 [2FLAG::csr-1 + Cbr-unc-119(+)] II. Single-copy insertion in the MosSCI locus ttTi5605 (LG II). The 2FLAG::csr-1 transgene was designed to express proteins with a double FLAG tag instead of the N169 of CSR-1a and N6 of CSR-1b. The linker sequence between the two FLAG tags has a NotI site. The insertion can be checked by PCR with the following primers: CACACTCGATTCTACGCCAA (at the 3'-side of csr-1) and ATCGGGAGGCGAACCTAACTG (near ttTi5605 on LG II). Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.

Proper citation: RRID:WB-STRAIN:WBStrain00055735 Copy   


http://www.wormbase.org/db/get?name=WBStrain00055734

Source Database: WormBase (WB)
Affected Genes: WBGene00006762(unc-25)
Genomic Alteration: WBGene00006762(unc-25)
Availability: unknown
Source References: EMPTY
Synonyms: unc-25(e156) III; hpIs673; ljIs131.
Notes: hpIs673 [rgef-1p::Chrimson::UrSL2::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Shrinker. All neurons are marked with red fluorescence. Pan-neuronal activation and muscle contraction upon green light illumination with ATR. Reference: Lu Y, et al. 2022. Current Biology (In Press).

Proper citation: RRID:WB-STRAIN:WBStrain00055734 Copy   


  • RRID:WB-STRAIN:WBStrain00055685

http://www.wormbase.org/db/get?name=WBStrain00055685

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: hpIs740.
Notes: hpIs740 [twk-40(s)p::GCaMP6s::wScarlet + lin-15(+)]. GCaMP and RFP expression in AVA, AVB, AVE and DVA. Reference: Lu Y, et al. 2022. Current Biology (In Press).

Proper citation: RRID:WB-STRAIN:WBStrain00055685 Copy   


  • RRID:WB-STRAIN:WBStrain00055684

http://www.wormbase.org/db/get?name=WBStrain00055684

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:38598630
Synonyms: hpIs758.
Notes: hpIs758 [rig-3p::LoxP::eBFP::LoxP::Chrimson::wCherry + twk-40(s)p::Cre + myo-2p::wCherry]. Pick animals with red fluorescence to maintain. Weak myo-2 and AVA Cherry expression. hpIs758 is a spontaneous insertion of hpEx4080. Reference: Lu Y, et al. 2022. Current Biology (In Press).

Proper citation: RRID:WB-STRAIN:WBStrain00055684 Copy   


  • RRID:WB-STRAIN:WBStrain00055687

http://www.wormbase.org/db/get?name=WBStrain00055687

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: hpIs717; ljIs131.
Notes: hpIs717 [acr-2(s)p::LoxP::eBFP::LoxP::Chrimson::wCherry + unc-17p::Cre + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Red fluorescence in motor neurons. Reference: Lu Y, et al. 2022. Current Biology (In Press).

Proper citation: RRID:WB-STRAIN:WBStrain00055687 Copy   


http://www.wormbase.org/db/get?name=WBStrain00055686

Source Database: WormBase (WB)
Affected Genes: WBGene00006762(unc-25)
Genomic Alteration: WBGene00006762(unc-25)
Availability: unknown
Source References: EMPTY
Synonyms: unc-25(e156) III; ljIs131; hpIs758.
Notes: ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. hpIs758 [rig-3p::LoxP::eBFP::LoxP::Chrimson::wCherry + twk-40(s)p::Cre + myo-2p::wCherry]. Pick animals with red fluorescence to maintain. Shrinker. RFP expression in AVA and a few other neurons. Reversal upon green light illumination with ATR. hpIs758 is a spontaneous insertion of hpEx4080. Reference: Lu Y, et al. 2022. Current Biology (In Press).

Proper citation: RRID:WB-STRAIN:WBStrain00055686 Copy   


http://www.wormbase.org/db/get?name=WBStrain00055683

Source Database: WormBase (WB)
Affected Genes: WBGene00006762(unc-25)
Genomic Alteration: WBGene00006762(unc-25)
Availability: unknown
Source References: EMPTY
Synonyms: unc-25(e156) III; hpIs593; ljIs131.
Notes: hpIs593 [ttr-39p::Chrimson::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Shrinker. D motor neurons are marked with red fluorescence. No behavioral change upon green light illumination with ATR. Reference: Lu Y, et al. 2022. Current Biology (In Press).

Proper citation: RRID:WB-STRAIN:WBStrain00055683 Copy   


  • RRID:WB-STRAIN:WBStrain00055726

http://www.wormbase.org/db/get?name=WBStrain00055726

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: hpIs625; ljIs131.
Notes: hpIs625 [ttr-39p::Arch::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Reference: Lu Y, et al. 2022. Current Biology (In Press).

Proper citation: RRID:WB-STRAIN:WBStrain00055726 Copy   


http://www.wormbase.org/db/get?name=WBStrain00055725

Source Database: WormBase (WB)
Affected Genes: WBGene00006762(unc-25)
Genomic Alteration: WBGene00006762(unc-25)
Availability: unknown
Source References: EMPTY
Synonyms: unc-25(e156) III; ljIs131.
Notes: ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Shrinker. Reference: Lu Y, et al. 2022. Current Biology (In Press).

Proper citation: RRID:WB-STRAIN:WBStrain00055725 Copy   


  • RRID:WB-STRAIN:WBStrain00055689

http://www.wormbase.org/db/get?name=WBStrain00055689

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: hpIs592; hpIs595.
Notes: hpIs592 [ttr-39p::Chrimson::wCherry + lin-15(+)]. hpIs595 [acr-2(s)p::GCaMP6s::wCherry + lin-15(+)]. Body relaxation upon green light illumination with ATR. Red fluorescence in D motor neurons. Reference: Lu Y, et al. 2022. Current Biology (In Press).

Proper citation: RRID:WB-STRAIN:WBStrain00055689 Copy   


http://www.wormbase.org/db/get?name=WBStrain00055688

Source Database: WormBase (WB)
Affected Genes: WBGene00006691(twk-40)
Genomic Alteration: WBGene00006691(twk-40)
Availability: unknown
Source References: PMID:38598630
Synonyms: twk-40(bln282[twk-40::TagRFP::ZF]) III; hpEx4120.
Notes: hpEx4120 [rgef-1p::GPI::YFP]. Pick YFP+ animals to maintain. TagRFP::ZF tag inserted into endogenous twk-40 locus.

Proper citation: RRID:WB-STRAIN:WBStrain00055688 Copy   


  • RRID:WB-STRAIN:WBStrain00055721

http://www.wormbase.org/db/get?name=WBStrain00055721

Source Database: WormBase (WB)
Affected Genes: WBGene00006691(twk-40)
Genomic Alteration: WBGene00006691(twk-40)
Availability: unknown
Source References: PMID:38598630
Synonyms: twk-40(hp834) III.
Notes: Loss-of-function allele. Loopy movement with increased reversals.

Proper citation: RRID:WB-STRAIN:WBStrain00055721 Copy   


  • RRID:WB-STRAIN:WBStrain00055723

http://www.wormbase.org/db/get?name=WBStrain00055723

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: hpIs371; hpIs365.
Notes: hpIs371 [unc-4p::miniSOG::SL2::wCherry + lin-15(+)]. hpIs365 [unc-25p::GCaMP3::wCherry + lin-15(+)]. Red fluorescence in motor neurons. Reference: Lu Y, et al. 2022. Current Biology (In Press).

Proper citation: RRID:WB-STRAIN:WBStrain00055723 Copy   


http://www.wormbase.org/db/get?name=WBStrain00055729

Source Database: WormBase (WB)
Affected Genes: WBGene00001457(flp-14)
Genomic Alteration: WBGene00001457(flp-14)
Availability: unknown
Source References: EMPTY
Synonyms: flp-14(gk1055) III; hpSi38; hpIs201.
Notes: hpSi38 [flp-14(+) + NeoR]. hpIs201[ceh-10p::GFP + lin-15(+)]. GFP expression in RID neuron. Neomycin-resistant. hpSi38 is a single copy miniMos insertion a wild-type genomic fragment containing flp-14 and fully rescues the flp-14 mutant behavioral defects and RID axon defects. Reference: Lim MA, et al. Elife. 2016 Nov 18;5:e19887. doi: 10.7554/eLife.19887. PMID: 27855782|"Made_by: Jun"

Proper citation: RRID:WB-STRAIN:WBStrain00055729 Copy   


http://www.wormbase.org/db/get?name=WBStrain00055676

Source Database: WormBase (WB)
Affected Genes: WBGene00006840(unc-116)
Genomic Alteration: WBGene00006840(unc-116)
Availability: unknown
Source References: EMPTY
Synonyms: unc-116(rh24sb79) III; oyIs14 V.
Notes: Made_by: Chen Ding|"oyIs14 [sra-6p::GFP + lin-15(+)]. Disrupted mitochondrial trafficking. sb79 is an intragenic suppressor of the rh24 gain-of-function allele. Reference: Ding C, et al. Elife. 2022 Mar 14;11:e73557. PMID: 35285800."

Proper citation: RRID:WB-STRAIN:WBStrain00055676 Copy   


  • RRID:WB-STRAIN:WBStrain00055670

http://www.wormbase.org/db/get?name=WBStrain00055670

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: wpIs107 I.
Notes: Made_by: Marc Hammarlund Lab|"wpIs107 [F49C12.10p::GFP] I. GFP expression in CAN neurons can be used to isolate CAN by FACS. F49C12.10 also known as nemt-1. Used by CeNGEN project for RNA-Seq (https:"|"wpIs107 [F49C12.10p::GFP] I. GFP expression in CAN neurons can be used to isolate CAN by FACS. Used by CeNGEN project for RNA-Seq (https:"

Proper citation: RRID:WB-STRAIN:WBStrain00055670 Copy   


http://www.wormbase.org/db/get?name=WBStrain00055671

Source Database: WormBase (WB)
Affected Genes: WBGene00006752(unc-13)|WBGene00010259(ric-7)
Genomic Alteration: WBGene00006752(unc-13), WBGene00010259(ric-7)
Availability: unknown
Source References: EMPTY
Synonyms: wpIs98 unc-13(e51) I; ric-7(n2657) V.
Notes: Made_by: Chen Ding|"wpIs98 [itr-1pB::Chrimson::SL2::mCherry + odr-1p::RFP] I. Reference: Ding C & Hammarlund M. Elife. 2018 Oct 29;7. pii: e38829. doi: 10.7554/eLife.38829."

Proper citation: RRID:WB-STRAIN:WBStrain00055671 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X