Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes
Norway

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search
Reset search
On page 135 showing 2681 ~ 2700 out of 62,713 results
Snippet view Table view Download Top 1000 Results

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

http://www.wormbase.org/db/get?name=WBStrain00055148

Source Database: WormBase (WB)
Affected Genes: WBGene00004370(rig-3)
Genomic Alteration: WBGene00004370(rig-3)
Availability: unknown
Source References: EMPTY
Synonyms: rig-3(syb4763[rig-3::SL2::GFP::H2B]) X.
Notes: CRISPR/Cas9-engineered reporter allele. Reference: The enteric nervous system of C. elegans is specified by the Sine Oculis-like homeobox gene ceh-34. Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https:|"CRISPR/Cas9-engineered reporter allele. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https:"|"Made_by: Suny Biotech"

Proper citation: RRID:WB-STRAIN:WBStrain00055148 Copy   

http://www.wormbase.org/db/get?name=WBStrain00055147

Source Database: WormBase (WB)
Affected Genes: WBGene00016354(rig-6)
Genomic Alteration: WBGene00016354(rig-6)
Availability: unknown
Source References: EMPTY
Synonyms: rig-6(syb4729[rig-6::SL2::GFP::H2B]) II.
Notes: CRISPR/Cas9-engineered reporter allele. Reference: The enteric nervous system of C. elegans is specified by the Sine Oculis-like homeobox gene ceh-34. Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https:|"CRISPR/Cas9-engineered reporter allele. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https:"|"Made_by: Suny Biotech"

Proper citation: RRID:WB-STRAIN:WBStrain00055147 Copy   

http://www.wormbase.org/db/get?name=WBStrain00055142

Source Database: WormBase (WB)
Affected Genes: WBGene00006775(unc-39)
Genomic Alteration: WBGene00006775(unc-39)
Availability: unknown
Source References: EMPTY
Synonyms: unc-39(syb4537[unc-39::gfp]) V.
Notes: CRISPR/Cas9 engineered tagged endogenous locus. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https:|"CRISPR/Cas9 engineered tagged endogneous locus. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https:"|"Made_by: Suny Biotech"

Proper citation: RRID:WB-STRAIN:WBStrain00055142 Copy   

http://www.wormbase.org/db/get?name=WBStrain00055149

Source Database: WormBase (WB)
Affected Genes: WBGene00001466(gpla-1)
Genomic Alteration: WBGene00001466(gpla-1)
Availability: unknown
Source References: EMPTY
Synonyms: gpla-1(syb4861[flr-2::SL2::GFP::H2B]) V.
Notes: CRISPR/Cas9-engineered reporter allele. gpla-1 formerly known as flr-2. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https:|"CRISPR/Cas9-engineered reporter allele. Reference: The enteric nervous system of C. elegans is specified by the Sine Oculis-like homeobox gene ceh-34. Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https:"|"Made_by: Suny Biotech"

Proper citation: RRID:WB-STRAIN:WBStrain00055149 Copy   

http://www.wormbase.org/db/get?name=WBStrain00055137

Source Database: WormBase (WB)
Affected Genes: WBGene00013752(nlp-69)
Genomic Alteration: WBGene00013752(nlp-69)
Availability: unknown
Source References: EMPTY
Synonyms: nlp-69(syb4512[nlp-69::SL2::gfp::H2B]) V.
Notes: CRISPR/Cas9 engineered tagged endogenous locus. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https:|"CRISPR/Cas9 engineered tagged endogneous locus. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https:"|"Made_by: Suny Biotech"

Proper citation: RRID:WB-STRAIN:WBStrain00055137 Copy   

http://www.wormbase.org/db/get?name=WBStrain00055139

Source Database: WormBase (WB)
Affected Genes: WBGene00021275(dmsr-2)
Genomic Alteration: WBGene00021275(dmsr-2)
Availability: unknown
Source References: PMID:37935195
Synonyms: dmsr-2(syb4514 [dmsr-2::SL2::gfp::H2B]) I.
Notes: CRISPR/Cas9 engineered tagged endogenous locus. Reference: Cros C & Hobert O. Proc Natl Acad Sci USA. 2022 Sep 13;119(37):e2206817119. doi: 10.1073/pnas.2206817119. PMID: 36067313.|"CRISPR/Cas9 engineered tagged endogneous locus. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https:"|"Made_by: Suny Biotech"|"Supplementary_genotype dmsr-2(syb4514 [dmsr-2::SL2::gfp::H2B]) I"

Proper citation: RRID:WB-STRAIN:WBStrain00055139 Copy   

http://www.wormbase.org/db/get?name=WBStrain00055140

Source Database: WormBase (WB)
Affected Genes: WBGene00019616(nmur-2)
Genomic Alteration: WBGene00019616(nmur-2)
Availability: unknown
Source References: PMID:37935195
Synonyms: nmur-2(syb4517 [nmur-2::SL2::GFP::H2B)] II.
Notes: GFP tag inserted at the C-terminus of the endogenous nmur-2 locus by CRISPR. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.|"GFP tag inserted at the C-terminus of the endogenous nmur-2 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Ripoll-Sanchez L, et al. Neuron. 2023 Nov 15;111(22):3570-3589.e5. doi: 10.1016/j.neuron.2023.09.043. PMID: 37935195."|"Made_by: Suny Biotech"|"Supplementary_genotype nmur-2(syb4517 [nmur-2::SL2::GFP::H2B)] II"

Proper citation: RRID:WB-STRAIN:WBStrain00055140 Copy   

    • RRID:WB-STRAIN:WBStrain00055234

http://www.wormbase.org/db/get?name=WBStrain00055234

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:38096407
Synonyms: syIs572.
Notes: Made_by: Jun Young Oh/Shahla Gharib|"syIs572 [15xUAS::TeTx::SL2::mKate::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)] Neurotoxin cGAL effector."

Proper citation: RRID:WB-STRAIN:WBStrain00055234 Copy   

    • RRID:WB-STRAIN:WBStrain00055230

http://www.wormbase.org/db/get?name=WBStrain00055230

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:38096407, PMID:39024405
Synonyms: syIs595.
Notes: syIs595 [mec-17p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ALM, AVM, PLM, and PVM neurons.

Proper citation: RRID:WB-STRAIN:WBStrain00055230 Copy   

    • RRID:WB-STRAIN:WBStrain00055196

http://www.wormbase.org/db/get?name=WBStrain00055196

Source Database: WormBase (WB)
Affected Genes: WBGene00017954(F31E8.4)
Genomic Alteration: WBGene00017954(F31E8.4)
Availability: unknown
Source References: EMPTY
Synonyms: F31E8.4(sy2030) II.
Notes: Made_by: Heenam Park|"Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F31E8.4. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GATTCTCTTCAGCTGGTGGAAAACTGGATCTCT. Right flanking sequence: GTCTGgtaagtctatatacttcggacacattcaaatttg. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGGAAAACTGGATCTCTGTC. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616."

Proper citation: RRID:WB-STRAIN:WBStrain00055196 Copy   

    • RRID:WB-STRAIN:WBStrain00055232

http://www.wormbase.org/db/get?name=WBStrain00055232

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:38096407
Synonyms: syIs568.
Notes: Made_by: Chun-Hao Chen/Jun Young Oh|"syIs568 [15xUAS::tra-2(ic)::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)] cGAL effector to induce feminization"

Proper citation: RRID:WB-STRAIN:WBStrain00055232 Copy   

    • RRID:WB-STRAIN:WBStrain00055223

http://www.wormbase.org/db/get?name=WBStrain00055223

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:38096407
Synonyms: syIs536.
Notes: syIs536 [15xUAS::lin-3c::SL2::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)] cGAL effector for epidermal growth factor

Proper citation: RRID:WB-STRAIN:WBStrain00055223 Copy   

http://www.wormbase.org/db/get?name=WBStrain00055189

Source Database: WormBase (WB)
Affected Genes: WBGene00008626(nlp-79)
Genomic Alteration: WBGene00008626(nlp-79)
Availability: unknown
Source References: EMPTY
Synonyms: nlp-79(syb7564[nlp-79::SL2::GFP::H2B]) IV.
Notes: Endogenous locus tagged with SL2::GFP::H2B using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.|"Made_by: Suny Biotech"

Proper citation: RRID:WB-STRAIN:WBStrain00055189 Copy   

    • RRID:WB-STRAIN:WBStrain00055225

http://www.wormbase.org/db/get?name=WBStrain00055225

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: syIs554; syIs300
Notes: Made_by: JUN Young Oh/Shahla Gharib|"syIs554 [nmr-1p::NLS::cGAL(DBD)::gp41-1-N-intein::let-858 3'UTR + flp-20p::NLS::gp41-1-C-intein::cGAL(AD)::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. Split cGAL driver for PVC neuron. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFPmarker, but will consistently produce worms with the transgenic marker in next generation. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148."

Proper citation: RRID:WB-STRAIN:WBStrain00055225 Copy   

    • RRID:WB-STRAIN:WBStrain00055224

http://www.wormbase.org/db/get?name=WBStrain00055224

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: syIs537; syIs300
Notes: Made_by: Jun Young Oh/Shahla Gharib|"syIs537 [glr-3p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] cGAL driver for RIA neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFPmarker, but will consistently produce worms with the transgenic marker in next generation. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148."

Proper citation: RRID:WB-STRAIN:WBStrain00055224 Copy   

    • RRID:WB-STRAIN:WBStrain00055221

http://www.wormbase.org/db/get?name=WBStrain00055221

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: syIs532; syIs300
Notes: Made_by: Jun Young Oh/Shahla Gharib|"syIs532 [hlh-34p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] cGAL driver for AVH neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFPmarker, but will consistently produce worms with the transgenic marker in next generation. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148."

Proper citation: RRID:WB-STRAIN:WBStrain00055221 Copy   

    • RRID:WB-STRAIN:WBStrain00055228

http://www.wormbase.org/db/get?name=WBStrain00055228

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: syIs561.
Notes: Made_by: Jun Young Oh/Shahla Gharib|"syIs561 [ttx-3p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] cGAL driver for AIY neurons."

Proper citation: RRID:WB-STRAIN:WBStrain00055228 Copy   

    • RRID:WB-STRAIN:WBStrain00055193

http://www.wormbase.org/db/get?name=WBStrain00055193

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: utsIs3.
Notes: utsIs3 [rab-11.2p::YFP::unc-54 3'UTR]. Transcriptional reporter for rab-11.2 activation. YFP expression is low at baseline and activated in the intestine by lipid depletion. Reference: Watterson A, et al. Nature. 2022 May;605(7911):736-740. doi: 10.1038/s41586-022-04729-7. PMID: 35585236.

Proper citation: RRID:WB-STRAIN:WBStrain00055193 Copy   

    • RRID:WB-STRAIN:WBStrain00055194

http://www.wormbase.org/db/get?name=WBStrain00055194

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: utsIs4.
Notes: utsIs4 [nhr-49p::nhr-49::GFP + myo-2p::mCherry]. Strain was back-crossed to N2 following transgene integration (parental strain described in Ratnappan R, et al. PLoS Genet. 2014 Dec 4;10(12):e1004829. doi: 10.1371/journal.pgen.1004829. ). Reference: Watterson A, et al. Nature. 2022 May;605(7911):736-740. doi: 10.1038/s41586-022-04729-7. PMID: 35585236.

Proper citation: RRID:WB-STRAIN:WBStrain00055194 Copy   

    • RRID:WB-STRAIN:WBStrain00055333

http://www.wormbase.org/db/get?name=WBStrain00055333

Source Database: WormBase (WB)
Affected Genes: WBGene00006508(tns-1)
Genomic Alteration: WBGene00006508(tns-1)
Availability: unknown
Source References: PMID:39999212
Synonyms: tns-1(sy1813) I.
Notes: Made_by: Heenam Park|"Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of tns-1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAATTCTCTAGAGTTATACAAAGACAAATTAGTGGTGC. Right flanking sequence: AGGAGGTGGAATTCTAAAGAAGAGTAATGGAAAG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AGACAAATTAGTGGTGCAGG Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616."

Proper citation: RRID:WB-STRAIN:WBStrain00055333 Copy   

Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X

  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X

About

The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.

Recent News Entries

Join NIH's “It's About Time: Temporal Reasoning in Biomedical Knowledge Graphs Challenge”

dkNET community events and announcements in September, 2026

dkNET community events and announcements in August, 2026

Contact Us

Email: info_at_ dknet.org

Stay Connected

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch