Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes
Norway

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search
Reset search
On page 134 showing 2661 ~ 2680 out of 62,713 results
Snippet view Table view Download Top 1000 Results

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

http://www.wormbase.org/db/get?name=WBStrain00062749

Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: unknown
Source References: EMPTY
Synonyms: unc-119(ed3) III; qbcSi10 IV.
Notes: qbcSi10 [mex-5p::GFP::his-58::3XmiR-228(mut)::tbb-2 3UTR + unc-119(+)] IV. Germline-specific miR-228 miRNA GFP reporter with a mutation in the miRNA-binding site. Reference: Dallaire et al. Dev Cell. 2018 Oct 22;47(2):239-247.e4. doi: 10.1016/j.devcel.2018.08.022. PMID: 30245155.

Proper citation: RRID:WB-STRAIN:WBStrain00062749 Copy   

http://www.wormbase.org/db/get?name=WBStrain00062747

Source Database: WormBase (WB)
Affected Genes: WBGene00001330(eps-8)
Genomic Alteration: WBGene00001330(eps-8)
Availability: unknown
Source References: EMPTY
Synonyms: eps-8(cp441[eps-8::mNG-C1]) IV.
Notes: Made_by: Pu Zhang|"mNG reporter inserted into endogenous eps-8 locus. Reference: Zhang P, et al. 2023 Sep 4;222(9):e202302102. doi: 10.1083/jcb.202302102. PMID: 37351566.."

Proper citation: RRID:WB-STRAIN:WBStrain00062747 Copy   

http://www.wormbase.org/db/get?name=WBStrain00062741

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00005077(src-1)|WBGene00006753(unc-14)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00005077(src-1), WBGene00006753(unc-14)
Availability: unknown
Source References: EMPTY
Synonyms: src-1(lq185)/tmC20 [unc-14(tmIs1219) dpy-5(tm9715)] I; juIs76 II.
Notes: juIs76 [unc-25p::GFP + lin-15(+)] II. Precise deletion of src-1 generated by Cas9 genome editing. Balancer marked with myo-2p::Venus. Heterozygotes are wild-type with Venus+ pharynx, and will segregate wild-type with Venus+ pharynx (heterozygotes), sterile adults without Venus in pharynx (lq185 homozygotes), and Dpy with Venus+ pharynx (tmC20 homozygotes). GFP expression in GABAergic motor neurons. Reference: Mahadik S, et al. bioRxiv 2023.05.20.541322; doi: https:

Proper citation: RRID:WB-STRAIN:WBStrain00062741 Copy   

http://www.wormbase.org/db/get?name=WBStrain00062744

Source Database: WormBase (WB)
Affected Genes: WBGene00006823(unc-94)
Genomic Alteration: WBGene00006823(unc-94)
Availability: unknown
Source References: EMPTY
Synonyms: unc-94b(cp438[mNG-C1::unc-94b]) I.
Notes: Made_by: Pu Zhang|"mNG reporter inserted into endogenous unc-94b locus, specifically tagging the UNC-94B isoform. Reference: Zhang P, et al. 2023 Sep 4;222(9):e202302102. doi: 10.1083/jcb.202302102. PMID: 37351566."

Proper citation: RRID:WB-STRAIN:WBStrain00062744 Copy   

http://www.wormbase.org/db/get?name=WBStrain00062837

Source Database: WormBase (WB)
Affected Genes: WBGene00000459(ceh-38)|WBGene00000464(ceh-44)|WBGene00015934(ceh-48)
Genomic Alteration: WBGene00000459(ceh-38), WBGene00000464(ceh-44), WBGene00015934(ceh-48)
Availability: unknown
Source References: EMPTY
Synonyms: ceh-38(tm321) II; ceh-44(ot1015[ceh-44::gfp]) III; ceh-48(tm6112) IV; otDf1 X.
Notes: Made_by: Michael Cesar|"ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. CUT Quintuple-mutant background. Reduced pan-neuronal nuclear CEH-44::GFP expression. Please contact Oliver Hobert prior to publishing work using this strain."

Proper citation: RRID:WB-STRAIN:WBStrain00062837 Copy   

    • RRID:WB-STRAIN:WBStrain00062838

http://www.wormbase.org/db/get?name=WBStrain00062838

Source Database: WormBase (WB)
Affected Genes: WBGene00000084(aex-1)
Genomic Alteration: WBGene00000084(aex-1)
Availability: unknown
Source References: EMPTY
Synonyms: aex-1(ot1357) I.
Notes: ot1357 is CRISPR-engineered 5,741 bp deletion removing the entire aex-1 coding region, eliminating all spice isoforms. Sequence after edit: ACTTTTAACATTTTTAAAGCATTAGTTTTCCTTATGAATAGTCTATATTTTATCGACTGGCCGACATAAt. Reference: Sural S, et al. bioRxiv 2025.01.06.631508; doi: https:

Proper citation: RRID:WB-STRAIN:WBStrain00062838 Copy   

http://www.wormbase.org/db/get?name=WBStrain00062835

Source Database: WormBase (WB)
Affected Genes: WBGene00000912(daf-16)|WBGene00002101(ins-18)
Genomic Alteration: WBGene00000912(daf-16), WBGene00002101(ins-18)
Availability: unknown
Source References: EMPTY
Synonyms: ins-18(ot1326) daf-16(ot971[daf-16::GFP]) I.
Notes: ot1326 is CRISPR-engineered 2,029 bp deletion removing the entire ins-18 coding region. Sequence after edit: AGCTCATTTTAATTTAACACAATGGTCCACCGACTACGTGGAAGATCTTCTTGCCTACTGTGCCCCAATT. Reference: Sural S, et al. bioRxiv 2025.01.06.631508; doi: https:

Proper citation: RRID:WB-STRAIN:WBStrain00062835 Copy   

http://www.wormbase.org/db/get?name=WBStrain00062797

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: qySi205 I; sec-16A.1(qy234[mNG::sec16A.1]) III.
Notes: Made_by: Sherwood Lab|"qySi205 [lin-29p::icmt-1::mscarlet] I. MosSCI single copy insertion for anchor cell specific expression of prenylation enzyme icmt-1 and sec-16A.1 locus endogenously tagged with mNG at the N-terminus. Superficially wild-type. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804."

Proper citation: RRID:WB-STRAIN:WBStrain00062797 Copy   

    • RRID:WB-STRAIN:WBStrain00062830

http://www.wormbase.org/db/get?name=WBStrain00062830

Source Database: WormBase (WB)
Affected Genes: WBGene00000401(cdh-9)
Genomic Alteration: WBGene00000401(cdh-9)
Availability: unknown
Source References: EMPTY
Synonyms: cdh-9(ot1247) X.
Notes: CRISPR/Cas9 engineered deletion of full cdh-9 locus.|"Made_by: Maryam Majeed"

Proper citation: RRID:WB-STRAIN:WBStrain00062830 Copy   

    • RRID:WB-STRAIN:WBStrain00062795

http://www.wormbase.org/db/get?name=WBStrain00062795

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: qySi229 I.
Notes: Made_by: Sherwood Lab|"qySi229 [cdh-3p::lmp-1::mNG] I. MosSCI single copy insertion. Anchor cell specific expression of lysosomal protein lmp-1. Superficially wild-type. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804."

Proper citation: RRID:WB-STRAIN:WBStrain00062795 Copy   

http://www.wormbase.org/db/get?name=WBStrain00062833

Source Database: WormBase (WB)
Affected Genes: WBGene00000464(ceh-44)
Genomic Alteration: WBGene00000464(ceh-44)
Availability: unknown
Source References: EMPTY
Synonyms: ceh-44(ot1294[*ot1015[ceh-44::gfp]]) III.
Notes: Made_by: Michael Cesar|"ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. ot1294 is a deletion removing intron 7 from the endogenously-tagged ceh-44 locus, which also removes the UNC-75 binding site. No pan-neuronal nuclear GFP expression. Please contact Oliver Hobert prior to publishing work using this strain."

Proper citation: RRID:WB-STRAIN:WBStrain00062833 Copy   

http://www.wormbase.org/db/get?name=WBStrain00062834

Source Database: WormBase (WB)
Affected Genes: WBGene00000464(ceh-44)
Genomic Alteration: WBGene00000464(ceh-44)
Availability: unknown
Source References: EMPTY
Synonyms: ceh-44(ot1402[*ot1015[ceh-44::gfp]]) III.
Notes: Made_by: Michael Cesar|"ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. ot1402 is a deletion removing the UNC-75 binding site within intron 7 of the endogenously-tagged ceh-44 locus. Reduced pan-neuronal nuclear CEH-44::GFP expression. Please contact Oliver Hobert prior to publishing work using this strain."

Proper citation: RRID:WB-STRAIN:WBStrain00062834 Copy   

http://www.wormbase.org/db/get?name=WBStrain00062798

Source Database: WormBase (WB)
Affected Genes: WBGene00004510(rrf-3)
Genomic Alteration: WBGene00004510(rrf-3)
Availability: unknown
Source References: EMPTY
Synonyms: rrf-3(pk1426) II; qyIs221.
Notes: Made_by: Sherwood Lab|"qyIs221 [cdh-3p::GFP::ced-10]. Maintain at 20C or lower. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804."

Proper citation: RRID:WB-STRAIN:WBStrain00062798 Copy   

http://www.wormbase.org/db/get?name=WBStrain00062934

Source Database: WormBase (WB)
Affected Genes: WBGene00001918(his-44)|WBGene00002090(ins-7)
Genomic Alteration: WBGene00001918(his-44), WBGene00002090(ins-7)
Availability: unknown
Source References: EMPTY
Synonyms: ins-7(syb5424[ins-7::SL2::GFP::his-44]) IV.
Notes: Made_by: Suny Biotech|"SL2::GFP::HIS-44 tag inserted into the endogenous ins-7 locus. Reference: Sural S, et al. bioRxiv 2025.01.06.631508; doi: https:"

Proper citation: RRID:WB-STRAIN:WBStrain00062934 Copy   

http://www.wormbase.org/db/get?name=WBStrain00062938

Source Database: WormBase (WB)
Affected Genes: WBGene00022675(gbb-2)
Genomic Alteration: WBGene00022675(gbb-2)
Availability: unknown
Source References: EMPTY
Synonyms: gbb-2(syb5759[gbb-2::sl2::gfp::h2b]) IV.
Notes: Made_by: SunyBiotech|"SL2::GFP::H2B tags inserted at C-terminus of gbb-2 endogenous locus. Reference: Stefanakis N, et al. 2024 Feb 15. doi: 10.1038/s44318-024-00049-w. PMID: 38360995."

Proper citation: RRID:WB-STRAIN:WBStrain00062938 Copy   

http://www.wormbase.org/db/get?name=WBStrain00062892

Source Database: WormBase (WB)
Affected Genes: WBGene00000088(aex-5)|WBGene00001918(his-44)
Genomic Alteration: WBGene00000088(aex-5), WBGene00001918(his-44)
Availability: unknown
Source References: EMPTY
Synonyms: aex-5(ot1532[aex-5::SL2::gfp::his-44]) I.
Notes: SL2::GFP::HIS-44 tag inserted into the endogenous aex-5 locus. Reference: Sural S, et al. bioRxiv 2025.01.06.631508; doi: https:

Proper citation: RRID:WB-STRAIN:WBStrain00062892 Copy   

    • RRID:WB-STRAIN:WBStrain00062896

http://www.wormbase.org/db/get?name=WBStrain00062896

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: otIs927 V.
Notes: otIs927 [ges-1p::nlp-40::tagRFP-T::SL2::GFP::his-44::tbb-2 3 UTR + inx-6(prom18)::tagRFP-T::unc-54 3' UTR] V. Transgene allows monitoring of the secretion of NLP-40 neuropeptide from the intestine under different physiological conditions. The multicopy array was inserted at the oxTi553 landing site using the Fluorescent Landmark Interference (FLInt) method. Reference: Sural S, et al. bioRxiv 2025.01.06.631508; doi: https:

Proper citation: RRID:WB-STRAIN:WBStrain00062896 Copy   

http://www.wormbase.org/db/get?name=WBStrain00062893

Source Database: WormBase (WB)
Affected Genes: WBGene00006807(unc-75)
Genomic Alteration: WBGene00006807(unc-75)
Availability: unknown
Source References: EMPTY
Synonyms: unc-75(ot1539[mScarlet-I3::unc-75]) I.
Notes: Made_by: Karinna Pe (Hobert Lab)|"mScarlet-I3 tag inserted into endogenous unc-75 locus via CRISPR/Cas9 engineering. Reference: Cao WX, et al. (2024). bioRxiv: 2024.2006.2011.598534. https:"

Proper citation: RRID:WB-STRAIN:WBStrain00062893 Copy   

http://www.wormbase.org/db/get?name=WBStrain00062894

Source Database: WormBase (WB)
Affected Genes: WBGene00000084(aex-1)|WBGene00001918(his-44)
Genomic Alteration: WBGene00000084(aex-1), WBGene00001918(his-44)
Availability: unknown
Source References: EMPTY
Synonyms: aex-1(ot1543[aex-1::SL2::gfp::his-44]) I.
Notes: SL2::GFP::HIS-44 tag inserted into the endogenous aex-1 locus. Reference: Sural S, et al. bioRxiv 2025.01.06.631508; doi: https:

Proper citation: RRID:WB-STRAIN:WBStrain00062894 Copy   

    • RRID:WB-STRAIN:WBStrain00062933

http://www.wormbase.org/db/get?name=WBStrain00062933

Source Database: WormBase (WB)
Affected Genes: WBGene00004394(rol-1)
Genomic Alteration: WBGene00004394(rol-1)
Availability: unknown
Source References: EMPTY
Synonyms: rol-1::mNG(syb5033) II.
Notes: Made_by: SunyBiotech|"mNG inserted at C-terminus of endogenous rol-1 locus."

Proper citation: RRID:WB-STRAIN:WBStrain00062933 Copy   

Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X

  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X

About

The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.

Recent News Entries

Join NIH's “It's About Time: Temporal Reasoning in Biomedical Knowledge Graphs Challenge”

dkNET community events and announcements in September, 2026

dkNET community events and announcements in August, 2026

Contact Us

Email: info_at_ dknet.org

Stay Connected

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch