Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

On page 13 showing 241 ~ 260 out of 1,464 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:RGD_13782146

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13782146

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 13782146
Notes: Bace1 (-/-) rats were generated by SAGE Labs using zinc-finger nuclease (ZFN) technology to create a 137-base pair deletion spanning the translation initiation start site in exon 1 of the rat Bace1 gene, corresponding to chr8:48,766,315-48,766,452 (RGSC 5.0/rn5 assembly)

Proper citation: RRID:RGD_13782146 Copy   


  • RRID:RGD_13792575

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13792575

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown (as of 2018-09-13)
Alternate IDs: 13792575
Notes: These wild type rats are littermates of homozygous knockout rats from heterozygote matings. The Lepr knockout model possesses a 151 bp deletion spanning the exon 1/intron 1 junction of the Leptin gene. Homozygous knockout rats display loss of Leptin protein via Western blot. Homozygous knockout rats demonstrate significant weight gain compared to wild type littermates. Homozygous knockout rats show significantly elevated serum cholesterol levels

Proper citation: RRID:RGD_13792575 Copy   


  • RRID:RGD_13792573

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13792573

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Embryo (as of 2018-09-13)
Alternate IDs: 13792573
Notes: This ZFN model possesses a 151 bp deletion spanning exon 1/intron 1 junction of Leptin gene. Homozygous knockout rats display loss of Leptin protein via Western blot. Homozygous knockout rats demonstrate significant weight gain compared to wild type littermates. Homozygous knockout rats show significantly elevated serum cholesterol levels Horizon Discovery

Proper citation: RRID:RGD_13792573 Copy   


  • RRID:RGD_127285404

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=127285404

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 127285404
Notes: This strain was produced by injecting ZFNs targeting exon 6 of rat complement factor b (Cfb) (target sequence: CCCCTCGGGCTCCATGaatatcTACATGGTGCTGGATG),into SHR/NCrl rat embryos. The resulting mutation is a 19-bp deletion.

Proper citation: RRID:RGD_127285404 Copy   


  • RRID:RGD_14392817

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=14392817

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 14392817
Notes: CFTR ZFN knockout rats possess a 16 bp deletion in exon 3 of the Cystic Fibrosis transmembrane conductance regulator (Cftr), resulting in loss of protein expression. The homozygous mutant rats and wild-type rats are produced by crossing the Cftr heterozygous rats.

Proper citation: RRID:RGD_14392817 Copy   


  • RRID:RGD_14392813

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=14392813

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Embryo; Cryorecovery (as of 2023-06-06)
Alternate IDs: 14392813
Notes: Cftr ZFN knockout rats possess a 16 bp deletion in exon 3 of the Cystic Fibrosis transmembrane conductance regulator (Cftr), resulting in loss of protein expression. This Cftr heterozygous rats exhibited similar bioelectric and other characteristics to wild-type. inotiv

Proper citation: RRID:RGD_14392813 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=126928150

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 126928150
Notes: The CRISPR-Cas9 system targeted to exon 2 of the rat Cdkn1b was injected to zygotes derived from the Sprague-Dawley outbred rat strain. Two mutations with the highest potential impact on Cdkn1b function were transferred through the germline showing a 32-bp deletion (DEL-32, em1Musc) and a 65-bp deletion (DEL-65, em4Musc), both disrupting the open reading frame of the Cdkn1b gene. The selected mutations were breded to the ACI inbred strain for future study. This mutant strain ACI.Cg.-Cdkn1bem4Musc harbors 65-bp deletion of Cdkn1b exhibits same phenotype as the em1Musc with 32-bp deletion

Proper citation: RRID:RGD_126928150 Copy   


  • RRID:RGD_41404648

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=41404648

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 41404648
Notes: CRISPR/Cas9 system was used to introduce a 22-bp deletion at the sgRNA2 site of exon 2 in the rat Lrp5 gene of Crl:SD embryos.

Proper citation: RRID:RGD_41404648 Copy   


  • RRID:RGD_126925952

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=126925952

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 126925952
Notes: The Myh7b knockout SD rats were generated using the CRISPR/Cas9 system targeting exon 2, resulting 7 bases deletion of exon 2 and generated a new termination codon TGA in exon 3. The heterzygous Myh7b+/- rats were crossed to generate littermate controls. The birth ratio of wild type (WT):Myh7b+/-:Myh7b-/- was approximately 1:2:1, indicating that Myh7b-/- did not cause fetal death.

Proper citation: RRID:RGD_126925952 Copy   


  • RRID:RGD_13825147

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13825147

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 13825147
Notes: CRISPR/Cas9 system was used to introduce a 1-bp deletion in exon 1 of Per1 gene in SS/JrHsdMcwi rat embryos. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_13825147 Copy   


  • RRID:RGD_14394617

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=14394617

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 14394617
Notes: The Tph2em3Mcwi heterozygous mutant was created by injecting ZFNs targeting the sequence CATGGCTCCGACCCCctctacACCCCGGAACCG into DA/OlaHsd rat embryos. The resulting mutation is a 11-bp frameshift deletion in exon 7.

Proper citation: RRID:RGD_14394617 Copy   


  • RRID:RGD_124713544

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=124713544

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 124713544
Notes: This strain was established by injecting Jcl:Wistar embryo with CRISPR/Cas9 system to delete the cysteine at position 462 in exon 8, which is the 5th ligand of heme iron and an active center of Cyp27b1. The resulting mutation is a 25 amino acid deletion (75 bp deletion) in the target site. The mutant was maintained with CE-2 formula diet (CLEA Japan, Inc., Tokyo, Japan) containing 1.15% calcium and 2,100 IU vitamin D3/kg diet. Homozygotes Cyp27b1 mutants were maintained by mating of heterozygotes.

Proper citation: RRID:RGD_124713544 Copy   


  • RRID:RGD_126790496

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=126790496

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 126790496
Notes: The Shank2 KO rat line 13 was generated by zinc finger nuclease technology targeting exon 31 for deletion . Line 13 has a 437 bp deletion around and including the entire exon 31, thereby causing a frameshift and premature stop codon in all three known isoforms of the rat Shank2 mRNA

Proper citation: RRID:RGD_126790496 Copy   


  • RRID:RGD_124713548

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=124713548

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 124713548
Notes: This strain was established by injecting Jcl:Wistar embryo with CRISPR/Cas9 system to disrupt the array near the arginine codon (CGC) at position 270 of the Vdr gene. This resulted in 1bp deletion and caused premature stop at p266 of the Vdr gene. They were allowed food and water ad libitum and fed a CE-2 formula diet ( CLEA Japan, Inc., Tokyo, Japan) containing 1.15% calcium and 2,100 IU vitamin D3/kg diet. The Vdr knock out rats for analysis were fed an F-2 formula diet (Oriental Yeast Co., Tokyo, Japan) containing 0.74% calcium and 2000 IU vitamin D/kg diet12 after weaning because the CE-2diet partially reversed their rickets symptoms. Homozygotes Vdr knock out mutants were maintained by mating of heterozygotes.

Proper citation: RRID:RGD_124713548 Copy   


  • RRID:RGD_13792606

    This resource has 1+ mentions.

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13792606

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 13792606
Notes: The CRISPR/Cas9 genome editing system was used to generate Cd59 mutation in the Sprague Dawley embryos. The CRISPR/Cas9 targeting exon 3 of the rat Cd59 created a 11 bp-deletion (TGCAAAACAAA) in exon 3. No protein expression was detected in the blood smear of homozygous mutants.

Proper citation: RRID:RGD_13792606 Copy   


  • RRID:RGD_21079475

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=21079475

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 21079475
Notes: The Lepr knockout rats were generated by CRISPR/Cas9. Two pairs of synthesized oligonucleotides for gRNA targeting on the exon 4 of Lepr, TAGGCAAATCATCTATAACTTC and AAACGAAGTTATAGATGATTTG; TAGGCTGAAAGCTGTCTTTCAG and AAACCTGAAAGACAGCTTTCAG were microinjected into Sprague Dawley (originally from Charles River) zygotes. The rat was genotyped by PCR with the primers, 5-prime-CTTGTGTCCAGAGCCTTCCTATAAC and 5-prime-ATTCCCCATGTTGTCTAGTAGTGATC. For genotyping, a 662-bp fragment of WT and a 368-bp fragment of the Lepr knockout gene were amplified with PCR. Founder 2 was chosen to establish a colony (designated as Lepr-/-), which carried a 298-bp deletion from No. 90043 bp to 90341 bp in the Lepr genome DNA sequence (NC_005104.4) and a 4-bp insertion and resulted in a termination codon TGA, deleting 997 amino acid of LEPR. Western blot analysis of total protein from liver tissue of the Lepr-/- rats confirmed the absence of LEPR.

Proper citation: RRID:RGD_21079475 Copy   


  • RRID:RGD_13792682

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13792682

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 13792682
Notes: This strain was produced by injecting ZFNs into SD embryos. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 23 bp-deletion (TGCGCAGGCCTGAGGGTGAGTCC) from the first coding exon of the rat Abcc6 gene. The mutation is predicted to cause out of frame translation and a premature stop codon. No protein in the homozygous mutant was detected by immunostaining.

Proper citation: RRID:RGD_13792682 Copy   


  • RRID:RGD_150429963

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=150429963

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 150429963
Notes: The Pmch mutant rat line was generated by target-selected ENU-driven mutagenesis, and high-throughput resequencing of genomic target sequences in progeny from mutagenized rats (Wistar/Crl background) revealed an ENU-induced premature stop codon in exon 1(K50X) of Pmch in a rat. The heterozygous mutant rat was backcrossed to wild-type Wistar background for six generations to eliminate confounding effects from background mutations induced by ENU.

Proper citation: RRID:RGD_150429963 Copy   


  • RRID:RGD_13800749

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13800749

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 13800749
Notes: CRISPR/Cas9 system was used to introduce a 84-bp deletion and skipping of exon 5 of the Glp1r gene in Lew/NCrl embryos. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_13800749 Copy   


  • RRID:RGD_13825199

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13825199

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 13825199
Notes: The Mc4r mutant rat line was generated by target-selected ENU-driven mutagenesis, and high-throughput resequencing of genomic target sequences in progeny from mutagenized rats (Wistar/Crl background) revealed an ENU-induced premature stop codon in helix 8 (K314X) of Mc4r. The heterozygous mutant rat was backcrossed to wild-type Wistar background for six generations to eliminate confounding effects from background mutations induced by ENU.

Proper citation: RRID:RGD_13825199 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X