Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
SS-Hvcn1em2Mcwi-/- Resource Report Resource Website |
RRID:RGD_6893439 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence CACACCCAGGCCATCCCTGgacttCAGGAGCCGGCTAAGGAA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp deletion in exon 5. | 6893439 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2017-01-26) | 6893439 | 2026-09-05 06:52:30 | 0 | |||||
|
SS-Nppbem4Mcwi-/- Resource Report Resource Website |
RRID:RGD_5686734 | Rattus norvegicus | ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. | 5686734 | mutant | Rat Genome Database (RGD) | RGD | Cryorecovery (as of 2018-09-05) | 5686734 | 2026-09-05 06:52:30 | 0 | |||||
|
SS-Tgfb1em3Mcwi+/- Resource Report Resource Website |
RRID:RGD_5688119 | Rattus norvegicus | ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained heterozygous breeders. | 5688119 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2021-08-24) | 5688119 | 2026-09-05 06:52:30 | 0 | |||||
|
SS-Tfdp2em2Mcwi+/+ Resource Report Resource Website |
RRID:RGD_5688113 | Rattus norvegicus | ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. | 5688113 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 5688113 | 2026-09-05 06:52:30 | 0 | |||||
|
SS-Nos3em13Mcwi Resource Report Resource Website |
RRID:RGD_6893431 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence GACTTCATCAATCAGTACtataaCTCGATCAAAAGGTGGGT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 165-bp deletion including part of exon 3, intron 3, and part of exon 4 | 6893431 | mutant | Rat Genome Database (RGD) | RGD | Live Animals; Cryopreserved Sperm (as of 2017-01-26) | 6893431 | 2026-09-05 06:52:30 | 0 | |||||
|
SS-Tfdp2em2Mcwi-/- Resource Report Resource Website |
RRID:RGD_5688111 | Rattus norvegicus | ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. | 5688111 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2018-09-05) | 5688111 | 2026-09-05 06:52:30 | 0 | |||||
|
SS-Abcb1bem2Mcwi Resource Report Resource Website |
RRID:RGD_6893600 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence GAAAGCTGCCCACCTCATGgatgtgGCCGGAAACAAGGTGGGA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 98-bp frameshift deletion in exon 4. | 6893600 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2017-07-24) | 6893600 | 2026-09-05 06:52:30 | 0 | |||||
|
SS-Plod1em1Mcwi-/- Resource Report Resource Website |
RRID:RGD_5686762 | Rattus norvegicus | ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. | 5686762 | mutant | Rat Genome Database (RGD) | RGD | Cryorecovery (as of 2018-09-05) | 5686762 | 2026-09-05 06:52:30 | 0 | |||||
|
SS-Plekha7em4Mcwi+/+ Resource Report Resource Website |
RRID:RGD_5686760 | Rattus norvegicus | ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. | 5686760 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 5686760 | 2026-09-05 06:52:30 | 0 | |||||
|
SS-Fynem1Mcwi Resource Report Resource Website |
RRID:RGD_6893440 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence TCCATCCCGAACTACAACaacttcCACGCAGCCGGGGGCCAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp deletion in exon 4. | 6893440 | mutant | Rat Genome Database (RGD) | RGD | Extinct | 6893440 | 2026-09-05 06:52:30 | 0 | |||||
|
SS-Plekha7em4Mcwi-/- Resource Report Resource Website |
RRID:RGD_5686758 | Rattus norvegicus | ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. | 5686758 | mutant | Rat Genome Database (RGD) | RGD | Live Animals; Cryopreserved Sperm (as of 2018-09-05) | 5686758 | 2026-09-05 06:52:30 | 0 | |||||
|
(SDxF344)F1-Rbm20m1Mlgw+/+ Resource Report Resource Website |
RRID:RGD_7241596 | Rattus norvegicus | Heterozygous offsprings were intercrossed and maintained as wild type | 7241596 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm | 7241596 | 2026-09-05 06:52:32 | 0 | |||||
|
(SDxF344)F1xBN-Rbm20m1Mlgw+/+ Resource Report Resource Website |
RRID:RGD_7241595 | Rattus norvegicus | Heterozygous offspring were intercrossed and maintained as wild type | 7241595 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm | 7241595 | 2026-09-05 06:52:32 | 0 | |||||
|
(SDxF344)F1-Rbm20m1Mlgw Resource Report Resource Website |
RRID:RGD_7241594 | Rattus norvegicus | This mutation, a deletion in chromosome 1 between bp 260,070,892 and 260,166,363, was originally found in the offspring of Hsd:SD x Hsd:SD. The phenotype was an altered titin isoform expression in the offspring. The parent carrier was identified by crossing both the male and the female Hsd:SD with F344/NHsd. This mutation is maintained on Hsd:SD X F344/NHsd. | 7241594 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2017-01-25) | 7241594 | 2026-09-05 06:52:32 | 0 | |||||
|
(SDxF344)F1xBN-Rbm20m1Mlgw Resource Report Resource Website |
RRID:RGD_7241597 | Rattus norvegicus | This mutation, a deletion in chromosome 1 between bp 260,070,892 and 260,166,363, was originally found in the offspring of Hsd:SD x Hsd:SD. The phenotype was an altered titin isoform expression in the offspring. The parent carrier was identified by crossing both the male and the female Hsd:SD with F344/NHsd. This mutation is maintained on Hsd:SD X F344/NHsd. | 7241597 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2017-01-25) | 7241597 | 2026-09-05 06:52:32 | 0 | |||||
|
WDB-ROSA26em1(RT2)Nips Resource Report Resource Website |
RRID:RGD_8552371 | Rattus norvegicus | This strain was produced by knock-in in the rat ROSA26 locus using the construct 5' arm--tdTomato--IRES-Puro^r-pA--3' arm (11 kb) to the WDB/Nips strain. ROSA26 is a synonym for rat Thumpd3-as1 (RGD:6491660) and is used as an official symbol for rat strain nomenclature. Section of Mammalian Transgenesis Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, Okazaki Aichi, JAPAN | 8552371 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 8552371 | 2026-09-05 06:52:32 | 0 | |||||
|
LE-Pink1em1Sage-/- Resource Report Resource Website |
RRID:RGD_7241049 | Rattus norvegicus | ZFN mutant founders were backcrossed with Crl:LE to get heterozygous offspring which were intercrossed and offspring maintained as homozygous. This allele was made by ZFN mutagenesis. The resulting mutation is a 26-bp frameshift deletion in exon 4 (ACTACTACCCAGAAGGCCTGGGCCAC). inotiv | 7241049 | mutant | Rat Genome Database (RGD) | RGD | Live Animals (as of 2024-11-26) | 7241049 | 2026-09-05 06:52:32 | 0 | |||||
|
LE-Park7em1Sage Resource Report Resource Website |
RRID:RGD_7241048 | Rattus norvegicus | This strain was produced by injecting ZFNs into Crl:LE rat embryos. The resulting mutation is a 9-bp deletion with 1-bp insertion in exon 5 Sigma Advanced Genetic Engineering Labs | 7241048 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 7241048 | 2026-09-05 06:52:32 | 0 | |||||
|
LE-Lrrk1em1SageLrrk2em1Sage Resource Report Resource Website |
RRID:RGD_7241047 | Rattus norvegicus | This strain was produced by crossing LE-Lrrk1em1Sage with LE-Lrrk2em1Sage Horizon Discovery | 7241047 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Embryo (as of 2017-06-06) | 7241047 | 2026-09-05 06:52:32 | 0 | |||||
|
KHR/Kyo-/- Resource Report Resource Website |
RRID:RGD_7800702 | Rattus norvegicus | Kaken hairless rat were detected by Kimura from Gunn's rat at Kaken Pharmaceuticals in 1987. 2002 introduced to Kyoto University (F36). National BioResource Project for the Rat in Japan | 7800702 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Embryo; Cryopreserved Sperm | 7800702 | 2026-09-05 06:52:31 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.