Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00051813
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: zdIs13 IV; vlcEx1290.
Notes: zdIs13 [tph-1p::GFP] IV. vlcEx1288 [hsp16.2p::lag-1D(cDNA) + ttx-3::mCherry + rol-6(su1006)]. Pick Rollers to maintain. Heatshock induces expression of LAG-1D. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334
Proper citation: RRID:WB-STRAIN:WBStrain00051813 Copy
http://www.wormbase.org/db/get?name=WBStrain00051818
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:38302462
Synonyms: jsSi1669 IV.
Notes: jsSi1669 [loxP::mex-5p::FLP::D5::sl2::mNG::glh-2::3 rpl-28p::FRT::GFP::his-58::FRT3] IV. Single component RMCE landing site on Chr IV adjacent to the site of the commonly used ttTi10882 MosSCi insertion site.
Proper citation: RRID:WB-STRAIN:WBStrain00051818 Copy
http://www.wormbase.org/db/get?name=WBStrain00051817
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:39652010
Synonyms: jsSi1579 II; bqSi711 IV.
Notes: jsSi1579 [loxP::rpl-28p::FRT::GFP::his-58 FRT3] II. bqSi711 [mex-5p::FLP::SL2::mNG + unc-119(+)] IV. Dual component RMCE landing site on Chr II adjacent to the site of the commonly used ttTi5605 MosSCi insertion site.
Proper citation: RRID:WB-STRAIN:WBStrain00051817 Copy
http://www.wormbase.org/db/get?name=WBStrain00051762
Source Database: WormBase (WB)
Affected Genes: WBGene00006920(vha-11)
Genomic Alteration: WBGene00006920(vha-11)
Availability: unknown
Source References: EMPTY
Synonyms: vha-11(luc130) IV.
Notes: Made_by: Paula Gutirrez-Prez|"vha-11 gain-of-function allele created by replacing the miR-1 binding site (ACATTCCA) in the 3' UTR of the endogenous locus with a NotI (GCGGCCGC) restriction site. Reference: Gutierrez-Prez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644."
Proper citation: RRID:WB-STRAIN:WBStrain00051762 Copy
http://www.wormbase.org/db/get?name=WBStrain00051761
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: lucEx421.
Notes: lucEx421 [mir-4813p::myr::GFP::unc-54 3UTR + ttx-3p::mCherry]. Pick mCherry+ animals to maintain. Reporter contains 1kb upstream mir-4813 promoter sequence and 1kb unc-54 3UTR downstream sequence. Provides a marker for pharyngeal muscle cell-cell fusion. Reference: Gutierrez-Prez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644.|"Made_by: Thomas Steinacker"
Proper citation: RRID:WB-STRAIN:WBStrain00051761 Copy
http://www.wormbase.org/db/get?name=WBStrain00051801
Source Database: WormBase (WB)
Affected Genes: WBGene00006670(twk-16)
Genomic Alteration: WBGene00006670(twk-16)
Availability: unknown
Source References: EMPTY
Synonyms: twk-16(syb2541[wrmScarlet::degron::twk-16]) X.
Notes: Made_by: Ravi Das|"wrmScarlet::degron tag inserted into the N-terminus of the endogenous twk-16 locus using CRISPR. wScarlet::TWK-16 expression in DVA and some neurons around the nerve ring. Reference: Das R, et al. Sci Adv. 2021 Sep 17;7(38):eabg4617. doi: 10.1126/sciadv.abg4617. PMID: 34533987"
Proper citation: RRID:WB-STRAIN:WBStrain00051801 Copy
http://www.wormbase.org/db/get?name=WBStrain00051767
Source Database: WormBase (WB)
Affected Genes: WBGene00006910(vha-1)|WBGene00006917(vha-8)|WBGene00006920(vha-11)|WBGene00006921(vha-12)|WBGene00010130(vha-14)|WBGene00013025(vha-13)
Genomic Alteration: WBGene00006910(vha-1), WBGene00006917(vha-8), WBGene00006920(vha-11), WBGene00006921(vha-12), WBGene00010130(vha-14), WBGene00013025(vha-13)
Availability: unknown
Source References: EMPTY
Synonyms: vha-14(luc138) vha-1(luc132) III; vha-11(luc130) vha-8(luc135) IV; vha-13(luc133) V; vha-12(luc139) X.
Notes: Made_by: Paula Gutirrez-Prez|"vha gain-of-function alleles created by replacing the miR-1 binding sites (ACATTCCA) in the 3' UTRs of the endogenous loci with a NotI (GCGGCCGC) restriction site. (vha-12 gain-of-function allele was created by replacing three miR-1 binding sites (ACATTCCA) with NotI (GCGGCCGC), BamHI (GGATCC), and EcoRI (GAATTC) restriction sites.) Referred as 6x-vhaNotI. Reference: Gutierrez-Prez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644."
Proper citation: RRID:WB-STRAIN:WBStrain00051767 Copy
http://www.wormbase.org/db/get?name=WBStrain00051766
Source Database: WormBase (WB)
Affected Genes: WBGene00006917(vha-8)
Genomic Alteration: WBGene00006917(vha-8)
Availability: unknown
Source References: EMPTY
Synonyms: vha-8(luc135) IV.
Notes: Made_by: Paula Gutirrez-Prez|"vha-8 gain-of-function allele created by replacing the miR-1 binding site (ACATTCCA) in the 3' UTR of the endogenous locus with a NotI (GCGGCCGC) restriction site. Reference: Gutierrez-Prez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644."
Proper citation: RRID:WB-STRAIN:WBStrain00051766 Copy
http://www.wormbase.org/db/get?name=WBStrain00051805
Source Database: WormBase (WB)
Affected Genes: WBGene00023497(lin-15B)|WBGene00023498(lin-15A)
Genomic Alteration: WBGene00023497(lin-15B), WBGene00023498(lin-15A)
Availability: unknown
Source References: EMPTY
Synonyms: nIs686 III; lin-15B&lin-15A(n765) X.
Notes: nIs686 [gpa-16p::GCaMP3::unc-54 3' UTR + lin-15(+)] III. Expression of GCaMP in RIP, pharyngeal muscle (pm2, pm3, and dimly/occasionally in pm1), mc1 marginal cells, and other unidentified cells. Derived by gamma-irradiation of nEx2309 in parental strain MT23222 and out-crossed five times to MT8189 lin-15B&lin-15A(n765). Reference: Sando SR, et al. eLife 2021;10:e59341 doi: 10.7554/eLife.59341
Proper citation: RRID:WB-STRAIN:WBStrain00051805 Copy
http://www.wormbase.org/db/get?name=WBStrain00051804
Source Database: WormBase (WB)
Affected Genes: WBGene00003004(lin-15)
Genomic Alteration: WBGene00003004(lin-15)
Availability: unknown
Source References: EMPTY
Synonyms: nIs348 IV; lin-15AB(n765) X.
Notes: nIs348 [ceh-28p::4XNLS::mCherry + lin-15(+)] IV. Reporter construct contains 2.4 kb of ceh-28 promoter. Reference: Hirose T, et al. Proc Natl Acad Sci. 2010 Aug 31;107(35):15479-84. PMID: 20713707
Proper citation: RRID:WB-STRAIN:WBStrain00051804 Copy
http://www.wormbase.org/db/get?name=WBStrain00051769
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00006910(vha-1)
Genomic Alteration: WBGene00000254(bli-4), WBGene00006910(vha-1)
Availability: unknown
Source References: EMPTY
Synonyms: vha-1(luc161) III/hT2[bli-4(e937) let-?(q782) qIs48] (I;III).
Notes: Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP, arrested hT2 aneuploids, and non-GFP luc161 homozygotes (embryonic lethal). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick wild-type GFP and check for correct segregation of progeny to maintain. vha-1(luc161) is a 454 bp deletion removing most of the coding sequence. Reference: Gutierrez-Prez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644.|"Made_by: Paula Gutirrez-Prez"
Proper citation: RRID:WB-STRAIN:WBStrain00051769 Copy
http://www.wormbase.org/db/get?name=WBStrain00051802
Source Database: WormBase (WB)
Affected Genes: WBGene00006616(trp-4)
Genomic Alteration: WBGene00006616(trp-4)
Availability: unknown
Source References: EMPTY
Synonyms: trp-4(mir35mir36[trp-4::gfp]) I.
Notes: GFP tag inserted into the N-terminus of the endogenous trp-4 locus using a two-step nested CRISPR method. The GFP signal is more prominent on the tip of the nose of the animals. Reference: Das R, et al. Sci Adv. 2021 Sep 17;7(38):eabg4617. doi: 10.1126/sciadv.abg4617. PMID: 34533987|"Made_by: Ravi Das"
Proper citation: RRID:WB-STRAIN:WBStrain00051802 Copy
http://www.wormbase.org/db/get?name=WBStrain00051808
Source Database: WormBase (WB)
Affected Genes: WBGene00003387(mod-5)
Genomic Alteration: WBGene00003387(mod-5)
Availability: unknown
Source References: EMPTY
Synonyms: mod-5(vlc47[mod-5::T2A::mNeonGreen]) I.
Notes: Made_by: Carlos Mora-Martnez|"mNeonGreen tag inserted into endogenous mod-5 locus. Upstream flanking sequence: AAATTATCGATAGTTCTCTTTTAGATCCAATcCAcACtCTcACaCCAGTT. Downstream flanking sequence: TAGATAATTCTTGGTGTACTGTTGGAAGTCAACGATCGATAGCCGTGCAC. Guide sequence: ACTGGAGTAAGTGTATGAAT. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334"
Proper citation: RRID:WB-STRAIN:WBStrain00051808 Copy
http://www.wormbase.org/db/get?name=WBStrain00051807
Source Database: WormBase (WB)
Affected Genes: WBGene00001803(lite-1)|WBGene00004510(rrf-3)
Genomic Alteration: WBGene00001803(lite-1), WBGene00004510(rrf-3)
Availability: unknown
Source References: EMPTY
Synonyms: rrf-3(pk1426) II; lite-1(ce314) X; vlcEx1292.
Notes: Made_by: ngela Jimeno|"vlcEx1292 [srh-142p::mCherry::SL2::GCaMP3 + unc-122p::RFP]. Maintain at or below 20C; sterile at 25C. Pick animals with RFP+ coelomocytes to maintain. ADF-specific expression of GCaMP3. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334"
Proper citation: RRID:WB-STRAIN:WBStrain00051807 Copy
http://www.wormbase.org/db/get?name=WBStrain00051756
Source Database: WormBase (WB)
Affected Genes: WBGene00001170(egl-1)
Genomic Alteration: WBGene00001170(egl-1)
Availability: unknown
Source References: EMPTY
Synonyms: egl-1(cdb97) V.
Notes: Brood size slightly reduced at 25 degrees. egl-1(cdb97) contains engineered mutations in mir-35 binding site in the 3UTR region making the sequence complementary to the mir-35(cdb4) variant. Reference: Yang B, et al. Genes Dev. 2020 Sep 1;34(17-18):1227-1238. PMID: 32820039
Proper citation: RRID:WB-STRAIN:WBStrain00051756 Copy
http://www.wormbase.org/db/get?name=WBStrain00051755
Source Database: WormBase (WB)
Affected Genes: WBGene00003263(mir-35)
Genomic Alteration: WBGene00003263(mir-35)
Availability: unknown
Source References: EMPTY
Synonyms: mir-35(cdb2 cdb4) II.
Notes: Made_by: Bridget Donnelly|"Superficially wild-type. Seed mutation of mir-35 was made by two rounds of CRISPR/Cas9 editing. cdb2 is a 50 bp deletion of the mir-35 locus. cdb4 was created by successive homology-directed repair of the disrupted mir-35 locus with a protospacer to preserve the secondary structure of the primary and precursor hairpin. Reference: Yang B, et al. Genes Dev. 2020 Sep 1;34(17-18):1227-1238. PMID: 32820039"
Proper citation: RRID:WB-STRAIN:WBStrain00051755 Copy
http://www.wormbase.org/db/get?name=WBStrain00051754
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: wIs51 V; icbSi2.
Notes: Made_by: Mark Hintze|"wIs51 [SCMp::GFP + unc-119(+)]. icbSi2 [dpy-7p::mCherry::H2B::unc-54 + Cbr-unc-119(+)]. Seam cell nuclei labelled with GFP. hyp7 nuclei labelled with mCherry. Reference: Hintze M, et al. Genetics. 2020 Apr;214(4):927-939. doi: 10.1534/genetics.119.302896. PMID: 31988193."
Proper citation: RRID:WB-STRAIN:WBStrain00051754 Copy
http://www.wormbase.org/db/get?name=WBStrain00051742
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: kasIs7.
Notes: kasIs7 [snb-1p::C9 ubi + myo-2::GFP]. The transgene drives expression of 75 GGGGCC repeats under the control of snb-1 promoter. The repeats are flanked with human C9orf72 intronic sequences. Reference: https:|"Made_by: Yoshifumi Sonobe"
Proper citation: RRID:WB-STRAIN:WBStrain00051742 Copy
http://www.wormbase.org/db/get?name=WBStrain00051746
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: kasEx161.
Notes: kasEx161 [unc-11p::UAG neuro + myo-2::GFP]. Pick GFP+ to maintain array. The transgene drives expression of 75 GGGGCC repeats under the control of unc-11 promoter. The repeats are flanked with human C9orf72 intronic sequences, but the upstream CUG is mutated to UAG. Reference: Sonobe Y, et al. Nat Commun. 2021 Oct 15;12(1):6025. doi: 10.1038/s41467-021-26303-x. PMID: 34654821|"kasEx161 [unc-11p::UAG neuro + myo-2::GFP]. The transgene drives expression of 75 GGGGCC repeats under the control of unc-11 promoter. The repeats are flanked with human C9orf72 intronic sequences, but the upstream CUG is mutated to UAG. Reference: Sonobe Y, et al. Nat Commun. 2021 Oct 15;12(1):6025. doi: 10.1038/s41467-021-26303-x. PMID: 34654821"|"Made_by: Yoshifumi Sonobe"
Proper citation: RRID:WB-STRAIN:WBStrain00051746 Copy
http://www.wormbase.org/db/get?name=WBStrain00051745
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: kasEx159.
Notes: kasEx159 [unc-11p::(delta)C9 neuro + myo-2::GFP]. Pick GFP+ to maintain array. The transgene has the unc-11 promoter followed by nanoluciferase sequence and unc-54 3'UTR. Reference: Sonobe Y, et al. Nat Commun. 2021 Oct 15;12(1):6025. doi: 10.1038/s41467-021-26303-x. PMID: 34654821|"kasEx159 [unc-11p::(delta)C9 neuro + myo-2::GFP]. The transgene has the unc-11 promoter followed by nanoluciferase sequence and unc-54 3'UTR. Reference: Sonobe Y, et al. Nat Commun. 2021 Oct 15;12(1):6025. doi: 10.1038/s41467-021-26303-x. PMID: 34654821"|"Made_by: Yoshifumi Sonobe"
Proper citation: RRID:WB-STRAIN:WBStrain00051745 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.