Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00051714
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:34865044
Synonyms: ieSi58 IV; osIs182 V.
Notes: ieSi58 [eft-3p::degron::GFP::unc-54 3'UTR + Cbr-unc-119(+)] IV. osIs182 [eft-3p::AtTIR1(F79G) + LoxP + myo-2p::GFP + rps-27p::neoR + LoxP] V. ieSi58 is a single copy transgene inserted into chromosome IV (oxTi177) expressing degron::GFP in the soma. osIs182 is a single copy insertion of TIR1(F79G) into chromosome V (oxTi365) and expresses the improved version of TIR1 used for improved auxin-inducible degradation (AID2) technology. Reference: Negishi T, et al. Genetics. 2021 Dec 2;iyab218. doi: 10.1093/genetics/iyab218.|"Made_by: Takefumi Negishi"
Proper citation: RRID:WB-STRAIN:WBStrain00051714 Copy
http://www.wormbase.org/db/get?name=WBStrain00051719
Source Database: WormBase (WB)
Affected Genes: WBGene00001864(him-5)
Genomic Alteration: WBGene00001864(him-5)
Availability: unknown
Source References: EMPTY
Synonyms: qIs56 him-5(e1490) V; qEx557.
Notes: qIs56 [lag-2p::GFP + unc-119(+)] V. qEx557 [hsp-16p::ceh-22b + ttx-3::DsRed]. Him. Pick DsRed+ animals to maintain qEx557 array. Heat-shock can be used to drive the ectopic expression of CEH-22B (derived from Fire Lab vector pPD49.78). LAG-2::GFP is expressed the embryo, nerve cord, Z1/Z4, and DTCs. Reference: Lam N. et al. Curr Biol. 2006 Feb 7;16(3):287-95. doi: 10.1016/j.cub.2005.12.015. PMID: 16461282
Proper citation: RRID:WB-STRAIN:WBStrain00051719 Copy
http://www.wormbase.org/db/get?name=WBStrain00051661
Source Database: WormBase (WB)
Affected Genes: WBGene00001078(dpy-19)|WBGene00001609(glp-1)|WBGene00001862(him-3)|WBGene00006768(unc-32)|WBGene00012713(bckd-1A)
Genomic Alteration: WBGene00001078(dpy-19), WBGene00001609(glp-1), WBGene00001862(him-3), WBGene00006768(unc-32), WBGene00012713(bckd-1A)
Availability: unknown
Source References: EMPTY
Synonyms: unc-32(e189) bckd-1A(t1461)/qC1[dpy-19(1259) glp-1(q339)] III; him-3(e1147) IV.
Notes: Made_by: Vancouver KO Group|"Maternal-effect lethal mutation linked to unc-32(e189) and balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and viable Unc t1461 homozygotes that produce dead eggs. GE1742 is also homozygous for him-3(e1147) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation."
Proper citation: RRID:WB-STRAIN:WBStrain00051661 Copy
http://www.wormbase.org/db/get?name=WBStrain00051660
Source Database: WormBase (WB)
Affected Genes: WBGene00001078(dpy-19)|WBGene00001609(glp-1)|WBGene00001862(him-3)|WBGene00006768(unc-32)
Genomic Alteration: WBGene00001078(dpy-19), WBGene00001609(glp-1), WBGene00001862(him-3), WBGene00006768(unc-32)
Availability: unknown
Source References: EMPTY
Synonyms: unc-32(e189) top-3(t1470)/qC1[dpy-19(1259) glp-1(q339)] III; him-3(e1147) IV.
Notes: Made_by: Vancouver KO Group|"Maternal-effect lethal mutation linked to unc-32(e189) and balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and viable Unc t1470 homozygotes that produce arrested embryos. GE1735 is also homozygous for him-3(e1147) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation."
Proper citation: RRID:WB-STRAIN:WBStrain00051660 Copy
http://www.wormbase.org/db/get?name=WBStrain00051669
Source Database: WormBase (WB)
Affected Genes: WBGene00001078(dpy-19)|WBGene00001609(glp-1)|WBGene00001862(him-3)|WBGene00004075(pod-1)|WBGene00006768(unc-32)
Genomic Alteration: WBGene00001078(dpy-19), WBGene00001609(glp-1), WBGene00001862(him-3), WBGene00004075(pod-1), WBGene00006768(unc-32)
Availability: unknown
Source References: EMPTY
Synonyms: unc-32(e189) pod-1(t1614)/qC1[dpy-19(1259) glp-1(q339)] III; him-3(e1147) IV.
Notes: Made_by: Vancouver KO Group|"Maternal-effect lethal mutation linked to unc-32(e189) and balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and viable Unc t1614 homozygotes that do not produce viable progeny. GE2237 is also homozygous for him-3(e1147) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation."
Proper citation: RRID:WB-STRAIN:WBStrain00051669 Copy
http://www.wormbase.org/db/get?name=WBStrain00051701
Source Database: WormBase (WB)
Affected Genes: WBGene00002010(hsp-6)
Genomic Alteration: WBGene00002010(hsp-6)
Availability: unknown
Source References: PMID:39602251
Synonyms: hsp-6(mg585) V; mgIs73 V.
Notes: Made_by: Ruvkun|"mgIs73 [cyp-14A4p::GFP::cyp-14A4 3UTR + myo-2p::mCherry] V. Slow growth. Low brood size. Received as a replacement for GR2249. Reference: Mao K, et al. Cell Metab. 2019 Feb 14. pii: S1550-4131(19)30022-1."
Proper citation: RRID:WB-STRAIN:WBStrain00051701 Copy
http://www.wormbase.org/db/get?name=WBStrain00051667
Source Database: WormBase (WB)
Affected Genes: WBGene00001073(dpy-11)|WBGene00006761(unc-24)|WBGene00008140(xpf-1)|WBGene00019953(wapl-1)
Genomic Alteration: WBGene00001073(dpy-11), WBGene00006761(unc-24), WBGene00008140(xpf-1), WBGene00019953(wapl-1)
Availability: unknown
Source References: EMPTY
Synonyms: xpf-1(e1487) II; unc-24(e138) wapl-1(t1773)/nt1[let (m435)] IV; dpy-11(e224)/nt1[let (m435)] V.
Notes: him-9 is other name for xpf-1|"Made_by: Vancouver KO Group"|"Maternal effect lethal mutation linked to unc-24(e138) and pseudolinked to dpy-11(e224), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t1773 homozygotes that do not produce viable progeny. GE2153 is also homozygous for him-9(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation."|"Maternal effect lethal mutation linked to unc-24(e138) and pseudolinked to dpy-11(e224), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t1773 homozygotes that do not produce viable progeny. GE2153 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9."
Proper citation: RRID:WB-STRAIN:WBStrain00051667 Copy
http://www.wormbase.org/db/get?name=WBStrain00051700
Source Database: WormBase (WB)
Affected Genes: WBGene00000485(che-3)
Genomic Alteration: WBGene00000485(che-3)
Availability: unknown
Source References: EMPTY
Synonyms: che-3(cas528[gfp::che-3(R1384C)]) I.
Notes: GFP inserted into the endogenous che-3 gene at its N-terminus and R1384C mutation introduced by Cas9-triggered homologous recombination. Lipophilic dye filling is superficially wild-type and the amphid and phasmid sensory cilia are mildly shortened without evident IFT particle accumulation.
Proper citation: RRID:WB-STRAIN:WBStrain00051700 Copy
http://www.wormbase.org/db/get?name=WBStrain00051666
Source Database: WormBase (WB)
Affected Genes: WBGene00001073(dpy-11)|WBGene00006761(unc-24)|WBGene00008140(xpf-1)|WBGene00013024(cept-2)
Genomic Alteration: WBGene00001073(dpy-11), WBGene00006761(unc-24), WBGene00008140(xpf-1), WBGene00013024(cept-2)
Availability: unknown
Source References: EMPTY
Synonyms: xpf-1(e1487) II; unc-24(e138)/nt1[let (m435)] IV; dpy-11(e224) cept-2(t2007)/nt1[let (m435)] V.
Notes: him-9 is other name for xpf-1|"Made_by: Vancouver KO Group"|"Maternal effect lethal mutation linked to dpy-11(e224) and pseudolinked to unc-24(e138), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t2007 homozygotes that produce dead eggs. GE2122 is also homozygous for him-9(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation."|"Maternal effect lethal mutation linked to dpy-11(e224) and pseudolinked to unc-24(e138), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t2007 homozygotes that produce dead eggs. GE2122 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9."
Proper citation: RRID:WB-STRAIN:WBStrain00051666 Copy
http://www.wormbase.org/db/get?name=WBStrain00051705
Source Database: WormBase (WB)
Affected Genes: WBGene00012802(set-25)|WBGene00019883(met-2)
Genomic Alteration: WBGene00012802(set-25), WBGene00019883(met-2)
Availability: unknown
Source References: EMPTY
Synonyms: met-2(n4256) set-25(n5021) III; gwIs4 X.
Notes: gwIs4 [myo-3p::RFP + baf-1::GFP-lacI:::let-858 3'UTR] X. Worms are slow growing, with reduced brood size and become sterile at elevated temperatures. met-2 and set-25 mutants co-segregate with ~ 20cM distance. Expresses GFP-LacI from early embryogenesis and throughout development, which forms a small spot at the lacO array. RFP expression in muscles. Reference: Towbin BD, et al. Cell. 2012 Aug 31;150(5):934-47. PMID: 22939621|"Made_by: Benjamin Towbin"
Proper citation: RRID:WB-STRAIN:WBStrain00051705 Copy
http://www.wormbase.org/db/get?name=WBStrain00051704
Source Database: WormBase (WB)
Affected Genes: WBGene00000123(ama-1)|WBGene00001074(dpy-13)
Genomic Alteration: WBGene00000123(ama-1), WBGene00001074(dpy-13)
Availability: unknown
Source References: EMPTY
Synonyms: gwIs39 III; dpy-13(eI84) ama-1(m118m251) IV; gwIs58.
Notes: gwIs39 [baf-1::gfp-lacI::let-858 3'UTR + vit-5::GFP] III. gwIs58 [hsp-16.2p::mCherry::256xLacO::4xLexA + unc-119(+)]. Small transgene/large array. Slow growing and dumpy. Expresses GFP-LacI from early embryogenesis and throughout development, which forms a small spot at the lacO array. Worms have green intestine (from late L4 stage). Might still carry unc-119(ed3) in background. Reference: Rohner S, et al. J Cell Biol. 2013 Mar 4;200(5):589-604. doi: 10.1083/jcb.201207024. PMID: 23460676
Proper citation: RRID:WB-STRAIN:WBStrain00051704 Copy
http://www.wormbase.org/db/get?name=WBStrain00051709
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: xeSi302 II; gwIs114.
Notes: xeSi302 [nhx-2p::npp-9::GFP::BLRP::3xFLAG::unc-54 3'UTR + Cbr-unc-119(+)] II. gwIs114 [hsp-16.2p::hlh-1 + rol6(su1006)]. Intestine-specific expression of nuclear GFP reporter. Rollers have heat-shock-inducible expression of hlh-1 transcription factor. gwIs114 was generated using constructs provided by Michael W. Krause`s lab (NIDDK). Reference: Gonzalez-Sandoval A, et al. Cell. 2015 Dec 3;163(6):1333-47. doi: 10.1016/j.cell.2015.10.066. PMID: 26607792.
Proper citation: RRID:WB-STRAIN:WBStrain00051709 Copy
http://www.wormbase.org/db/get?name=WBStrain00051708
Source Database: WormBase (WB)
Affected Genes: WBGene00000415(ced-1)|WBGene00002989(lim-7)|WBGene00003004(lin-15)|WBGene00012802(set-25)|WBGene00019883(met-2)
Genomic Alteration: WBGene00000415(ced-1), WBGene00002989(lim-7), WBGene00003004(lin-15), WBGene00012802(set-25), WBGene00019883(met-2)
Availability: unknown
Source References: EMPTY
Synonyms: met-2(n4256) set-25(n5021) III; bcIs39 [lim-7p::ced-1::GFP + lin-15(+)] V.
Notes: Worms are slow growing, with reduced brood size and become sterile at elevated temperatures. CED-1::GFP used to detect apoptotic cells in germline. Reference: Zeller P, et al. Nat Genet. 2016 Nov;48(11):1385-1395. doi: 10.1038/ng.3672. PMID: 27668659.
Proper citation: RRID:WB-STRAIN:WBStrain00051708 Copy
http://www.wormbase.org/db/get?name=WBStrain00051775
Source Database: WormBase (WB)
Affected Genes: WBGene00000898(daf-2)
Genomic Alteration: WBGene00000898(daf-2)
Availability: unknown
Source References: EMPTY
Synonyms: daf-2(hq61[daf-2::mNeongreen]) III.
Notes: Made_by: Yan-Ping Zhang, Wen-Hong Zhang|"mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. Phenotypic assays have shown that this mNeonGreen tag does not perturb the function of the DAF-2 protein. DAF-2::mNeonGreen is expressed in neurons, XXX cells, vulval cells, germ cells, and oocytes with clear plasma membrane localization as expected for a cell surface receptor. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https:"
Proper citation: RRID:WB-STRAIN:WBStrain00051775 Copy
http://www.wormbase.org/db/get?name=WBStrain00051773
Source Database: WormBase (WB)
Affected Genes: WBGene00015776(dct-1)
Genomic Alteration: WBGene00015776(dct-1)
Availability: unknown
Source References: EMPTY
Synonyms: dct-1(luc194) X.
Notes: CRISPR/Cas9-engineered deletion removes the entire dct-1 coding sequence. Homozygote mutant animals are viable and have normal morphology. Outer left sequence: gtttcagagacgggtctttcctaaca Outer right sequence: ttccaaacaaaaattttaacgttcgactta sgRNA1: ACAGCAGACGGAGCAGTCAT sgRNA2: GTACAGTGAAATGAGGTAAG Reference: Gutierrez-Prez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644.|"CRISPR/Cas9-engineered deletion removes the entire dct-t coding sequence. Homozygote mutant animals are viable and have normal morphology. Outer left sequence: gtttcagagacgggtctttcctaaca Outer right sequence: ttccaaacaaaaattttaacgttcgactta sgRNA1: ACAGCAGACGGAGCAGTCAT sgRNA2: GTACAGTGAAATGAGGTAAG Reference: Gutierrez-Prez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644."|"Made_by: Paula Gutirrez-Prez"
Proper citation: RRID:WB-STRAIN:WBStrain00051773 Copy
http://www.wormbase.org/db/get?name=WBStrain00051772
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: unknown
Source References: EMPTY
Synonyms: oxIs322 II; unc-119(ed3) III; lucEx1311.
Notes: Made_by: Paula Gutirrez-Prez|"oxIs322 [myo-2p::mCherry::H2B + myo-3p::mCherry::H2B + Cbr-unc-119(+)]. lucEx1311 (myo-3p::R2pH::LAMP1::3xFLAG::unc-54 3UTR + ttx-3p::mCherry). Pick mCherry+ to maintain. Reference: Gutierrez-Perez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644."
Proper citation: RRID:WB-STRAIN:WBStrain00051772 Copy
http://www.wormbase.org/db/get?name=WBStrain00051779
Source Database: WormBase (WB)
Affected Genes: WBGene00000898(daf-2)|WBGene00006843(unc-119)
Genomic Alteration: WBGene00000898(daf-2), WBGene00006843(unc-119)
Availability: unknown
Source References: EMPTY
Synonyms: daf-2(hq363[daf-2::degron::mNeonGreen]) unc-119(ed3) III; ieSi38 IV.
Notes: ieSi38 [sun-1p::TIR1::mRuby::sun-1 3' UTR + Cbr-unc-119(+)] IV. Degron and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. A single copy transgene was inserted into chromosome IV (cxTi10882) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and early embryos. This strain can be used for auxin-inducible degradation (AID) of DAF-2 protein in the germ line.|"Made_by: Yan-Ping Zhang, Wen-Hong Zhang"
Proper citation: RRID:WB-STRAIN:WBStrain00051779 Copy
http://www.wormbase.org/db/get?name=WBStrain00051778
Source Database: WormBase (WB)
Affected Genes: WBGene00000898(daf-2)|WBGene00006843(unc-119)
Genomic Alteration: WBGene00000898(daf-2), WBGene00006843(unc-119)
Availability: unknown
Source References: EMPTY
Synonyms: ieSi61 II; daf-2(hq363[daf-2::degron::mNeonGreen]) unc-119(ed3) III.
Notes: ieSi61 [ges-1p::TIR1::mRuby::unc-54 3' UTR + Cbr-unc-119(+)] II. Degron and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. A single copy transgene was inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the intestine. This strain can be used for auxin-inducible degradation (AID) of DAF-2 protein in the intestine. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https:|"Made_by: Yan-Ping Zhang, Wen-Hong Zhang"
Proper citation: RRID:WB-STRAIN:WBStrain00051778 Copy
http://www.wormbase.org/db/get?name=WBStrain00051777
Source Database: WormBase (WB)
Affected Genes: WBGene00000898(daf-2)|WBGene00006843(unc-119)
Genomic Alteration: WBGene00000898(daf-2), WBGene00006843(unc-119)
Availability: unknown
Source References: EMPTY
Synonyms: hqSi8 II; daf-2(hq363[daf-2::degron::mNeonGreen]) unc-119(ed3) III.
Notes: hqSi8 [rgef-1p::TIR1::mRuby::unc-54 3UTR+Cbr-unc-119(+)] II. Degron and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. hqSi8 was generated by replacing the eft-3 promoter of the ieSi57 insertion (oxTi179 site) with the rgef-1 promoter using CRISPR/Cas9. This strain can be used for auxin-inducible degradation (AID) of DAF-2 protein in the neurons. hqSi8 previously known as hq373. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https:|"Made_by: Yan-Ping Zhang, Wen-Hong Zhang"
Proper citation: RRID:WB-STRAIN:WBStrain00051777 Copy
http://www.wormbase.org/db/get?name=WBStrain00051815
Source Database: WormBase (WB)
Affected Genes: WBGene00016421(cdc-7)
Genomic Alteration: WBGene00016421(cdc-7)
Availability: unknown
Source References: EMPTY
Synonyms: cdc-7(knu709) I.
Notes: CRISPR-engineered deletion removing entire cdc-7 gene. Out-crossed 3x to N2. Reference: Currey HN & Liachko NF. 2019. A CRISPR/Cas9-generated cdc-7 loss of function mutation does not cause temperature-dependent fertility defects. microPublication Biology. Jan 3;2019:10.17912.
Proper citation: RRID:WB-STRAIN:WBStrain00051815 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.