Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Species:caenorhabditis elegans (facet)

Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

62,713 Results - per page

Show More Columns | Download Top 1000 Results

Organism Name Proper Citation Species Synonyms Notes Phenotype Affected Gene Genomic Alteration Catalog Number Background Database Database Abbreviation Availability Source References Alternate IDs Record Last Update Mentions Count
RB2370
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00033046 Caenorhabditis elegans T21B6.5(ok3220) X. Made_by: OMRF Knockout Group|"T21B6.5 Homozygous. Outer Left Sequence: tgagcaatggattacaaccg. Outer Right Sequence: atgtccggagcttaatggtg. Inner Left Sequence: tgcgcggtaattggaaat. Inner Right Sequence: gagcactatcagtgggggaa. Inner Primer PCR Length: 1365. Deletion size: about 600 bp."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00011882(nstp-9) WBGene00011882(nstp-9) WB-STRAIN:WBStrain00033046 WormBase (WB) WB available WB-STRAIN:RB2370, CGC_RB2370 2026-08-29 09:21:52 0
RB2371
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00033047 Caenorhabditis elegans nhl-3(ok3223) II. Made_by: OMRF Knockout Group|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"W04H10.3 Homozygous. Outer Left Sequence: cacgtagcttcgggtcattt. Outer Right Sequence: aagaaatttgcattggagcg. Inner Left Sequence: agtctagcagatccacatggc. Inner Right Sequence: gtgacgccagcacattctta. Inner Primer PCR Length: 1246. Deletion size: about 500 bp." WBGene00003599(nhl-3) WBGene00003599(nhl-3) WB-STRAIN:WBStrain00033047 WormBase (WB) WB available WB-STRAIN:RB2371, CGC_RB2371 2026-08-29 09:21:52 0
RB2372
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00033048 Caenorhabditis elegans K06A1.5(ok3224) II. K06A1.5 Homozygous. Outer Left Sequence: ccgcagatccagatatgaca. Outer Right Sequence: tttctcgtacgcattgcatc. Inner Left Sequence: ccgtatggccagaaaacgta. Inner Right Sequence: ttgcaagacatgtgcaatagg. Inner Primer PCR Length: 1190. Deletion size: about 600 bp.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00019427(atg-16.2) WBGene00019427(atg-16.2) WB-STRAIN:WBStrain00033048 WormBase (WB) WB available PMID:39570954 WB-STRAIN:RB2372, CGC_RB2372 2026-08-29 09:21:52 0
RB2374
 
Resource Report
Resource Website
1+ mentions
RRID:WB-STRAIN:WBStrain00033049 Caenorhabditis elegans cnc-2(ok3226) V. Made_by: OMRF Knockout Group|"R09B5.3 Homozygous. Outer Left Sequence: accactcctttggtctcgaa. Outer Right Sequence: tcgacgtcatcatttggttc. Inner Left Sequence: ttttggaagtcgaccgaaac. Inner Right Sequence: catatcagttgtgagtatcaatggaa. Inner Primer PCR Length: 1164. Deletion size: about 600 bp."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00000556(cnc-2) WBGene00000556(cnc-2) WB-STRAIN:WBStrain00033049 WormBase (WB) WB available WB-STRAIN:RB2374, CGC_RB2374 2026-08-29 09:21:52 2
RB2377
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00033052 Caenorhabditis elegans R07B7.11(ok3230) V. Made_by: OMRF Knockout Group|"R07B7.11 Homozygous. Outer Left Sequence: ttggtcggaaatggaaagag. Outer Right Sequence: tctccgaaatcaaatcgtcc. Inner Left Sequence: cagtggaatgaaggctttgg. Inner Right Sequence: ttgagactgttctctttcaaattca. Inner Primer PCR Length: 1197. Deletion size: about 700 bp."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00011095(gana-1) WBGene00011095(gana-1) WB-STRAIN:WBStrain00033052 WormBase (WB) WB available WB-STRAIN:RB2377, CGC_RB2377 2026-08-29 09:21:52 0
RB2378
 
Resource Report
Resource Website
1+ mentions
RRID:WB-STRAIN:WBStrain00033053 Caenorhabditis elegans msh-6(ok3231) I. Made_by: OMRF Knockout Group|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y47G6A.11 Homozygous. Outer Left Sequence: accgctaggattttcggatt. Outer Right Sequence: gcccctgagttgcaaaatta. Inner Left Sequence: tggtattcggtatcaggagca. Inner Right Sequence: gcctctttcctgtgcacttt. Inner Primer PCR Length: 1282. Deletion size: about 400 bp." WBGene00003422(msh-6) WBGene00003422(msh-6) WB-STRAIN:WBStrain00033053 WormBase (WB) WB available WB-STRAIN:RB2378, CGC_RB2378 2026-08-29 09:21:52 1
RB2386
 
Resource Report
Resource Website
1+ mentions
RRID:WB-STRAIN:WBStrain00033061 Caenorhabditis elegans C37H5.3(ok3245) V. C37H5.3 Homozygous. Outer Left Sequence: gtagatcatctcgccccaaa. Outer Right Sequence: atatttctcgccctgccttc. Inner Left Sequence: catcagacccagaaactgcc. Inner Right Sequence: aatttgctggccaggtgtat. Inner Primer PCR Length: 1379. Deletion size: about 800 bp.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"WBStrain provided so WBPaper00060484 paper added based on AFP_Strain data." WBGene00016507(abhd-5.2) WBGene00016507(abhd-5.2) WB-STRAIN:WBStrain00033061 WormBase (WB) WB available PMID:33034119 WB-STRAIN:RB2386, CGC_RB2386 2026-08-29 09:21:52 1
RB2387
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00033062 Caenorhabditis elegans R05H5.7(ok3246) II. Made_by: OMRF Knockout Group|"R05H5.7 Homozygous. Outer Left Sequence: cgaagttttgagcttttggc. Outer Right Sequence: tcgaaaagaccgaattgctt. Inner Left Sequence: tttgattttaattgtggtaactacgg. Inner Right Sequence: ggtcacaggtgtgttgtgct. Inner Primer PCR Length: 1120. Deletion size: about 700 bp."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00011041(R05H5.7) WBGene00011041(R05H5.7) WB-STRAIN:WBStrain00033062 WormBase (WB) WB available WB-STRAIN:RB2387, CGC_RB2387 2026-08-29 09:21:52 0
RB2388
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00033063 Caenorhabditis elegans W04G3.1(ok3253) X. Made_by: OMRF Knockout Group|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"W04G3.1 Homozygous. Outer Left Sequence: aacgcattgaaccccactta. Outer Right Sequence: agctaacccaattctcgcct. Inner Left Sequence: caccgtgccctaattactca. Inner Right Sequence: actagtgcgccctacaggag. Inner Primer PCR Length: 1191. Deletion size: about 700 bp." WBGene00012255(lpr-6) WBGene00012255(lpr-6) WB-STRAIN:WBStrain00033063 WormBase (WB) WB available WB-STRAIN:RB2388, CGC_RB2388 2026-08-29 09:21:52 0
RB2466
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00033141 Caenorhabditis elegans F28D1.2(ok3406) IV. F28D1.2 Homozygous. Outer Left Sequence: cctcttctccctcctcatca. Outer Right Sequence: tcatttcactcgcacaggtc. Inner Left Sequence: ttcaacctcgtagttctcctcc. Inner Right Sequence: cgactggttgtcaccctttt. Inner Primer PCR Length: 1189. Deletion size: about 400 bp.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00009212(atz-1) WBGene00009212(atz-1) WB-STRAIN:WBStrain00033141 WormBase (WB) WB available WB-STRAIN:RB2466, CGC_RB2466 2026-08-29 09:21:54 0
RB2472
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00033147 Caenorhabditis elegans ZK970.1(ok3412) II. Made_by: OMRF Knockout Group|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"ZK970.1 Homozygous. Outer Left Sequence: acgaatcgaatggaatctgc. Outer Right Sequence: attgttttgggcaggagttg. Inner Left Sequence: ttatgtgctggaaccgaaatc. Inner Right Sequence: gcaacttcctatccttctggc. Inner Primer PCR Length: 1112. Deletion size: about 500 bp." WBGene00014171(nep-26) WBGene00014171(nep-26) WB-STRAIN:WBStrain00033147 WormBase (WB) WB available WB-STRAIN:RB2472, CGC_RB2472 2026-08-29 09:21:54 0
RB2476
 
Resource Report
Resource Website
1+ mentions
RRID:WB-STRAIN:WBStrain00033151 Caenorhabditis elegans tig-2(ok3416) V. F39G3.8 Homozygous. Outer Left Sequence: gagttgtggaggcggatcta. Outer Right Sequence: agtgtttccagacaggccac. Inner Left Sequence: tcagagctttagcggcaaat. Inner Right Sequence: aacaaatccgcgagctctt. Inner Primer PCR Length: 1207. Deletion size: about 800 bp.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00006570(tig-2) WBGene00006570(tig-2) WB-STRAIN:WBStrain00033151 WormBase (WB) WB available WB-STRAIN:RB2476, CGC_RB2476 2026-08-29 09:21:54 3
RB2477
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00033152 Caenorhabditis elegans tmd-2(ok3417) V. C08D8.2 Homozygous. Outer Left Sequence: ttacagaggcaatgcacgag. Outer Right Sequence: aaccggggatatcatcacaa. Inner Left Sequence: ccgaattgtttcttgggatg. Inner Right Sequence: tacaatccgttgcgtcaaaa. Inner Primer PCR Length: 1182. Deletion size: about 800 bp.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00006582(tmd-2) WBGene00006582(tmd-2) WB-STRAIN:WBStrain00033152 WormBase (WB) WB available WB-STRAIN:RB2477, CGC_RB2477 2026-08-29 09:21:54 0
RB2480
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00033155 Caenorhabditis elegans T02G5.3(ok3420) II. Made_by: OMRF Knockout Group|"T02G5.3 Homozygous. Outer Left Sequence: ccgaatgcctgaatatcaca. Outer Right Sequence: tcgtcctcttccacttttgg. Inner Left Sequence: tctaactatgctcggccacc. Inner Right Sequence: tccgagaccggctaccttat. Inner Primer PCR Length: 1158. Deletion size: about 500bp."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00020163(T02G5.3) WBGene00020163(T02G5.3) WB-STRAIN:WBStrain00033155 WormBase (WB) WB available WB-STRAIN:RB2480, CGC_RB2480 2026-08-29 09:21:54 0
RB2483
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00033158 Caenorhabditis elegans Y48A6B.8(ok3423) III. Made_by: OMRF Knockout Group|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y48A6B.8 Homozygous. Outer Left Sequence: cggagacatcatgctcattg. Outer Right Sequence: gggacagcacagacagatca. Inner Left Sequence: gaccggttgcactgtaatga. Inner Right Sequence: aaatgggcaacgttgtgaag. Inner Primer PCR Length: 1237. Deletion size: about 700 bp." WBGene00012969(Y48A6B.8) WBGene00012969(Y48A6B.8) WB-STRAIN:WBStrain00033158 WormBase (WB) WB available WB-STRAIN:RB2483, CGC_RB2483 2026-08-29 09:21:54 0
RB2485
 
Resource Report
Resource Website
1+ mentions
RRID:WB-STRAIN:WBStrain00033160 Caenorhabditis elegans Y9C9A.16(ok3440) IV. Made_by: OMRF Knockout Group|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y9C9A.16 Homozygous. Outer Left Sequence: gtcgacagttttcaagtgcg. Outer Right Sequence: ctcgaaaacttccaagtggc. Inner Left Sequence: tgatgcagctgtttttgcat. Inner Right Sequence: tgtcggtggaggtctaatga. Inner Primer PCR Length: 1187. Deletion size: about 400 bp." WBGene00021183(Y9C9A.16) WBGene00021183(Y9C9A.16) WB-STRAIN:WBStrain00033160 WormBase (WB) WB available WB-STRAIN:RB2485, CGC_RB2485 2026-08-29 09:21:54 1
RB2447
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00033122 Caenorhabditis elegans str-220(ok3374) IV. C42D4.9 Homozygous. Outer Left Sequence: tgtaacacggcaggttcaaa. Outer Right Sequence: acattccgttttccatttgc. Inner Left Sequence: ttggcgccacttcttcttta. Inner Right Sequence:ccagactgtccaaaatccaga . Inner Primer PCR Length: 1146. Deletion size: about 300 bp.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00006251(str-220) WBGene00006251(str-220) WB-STRAIN:WBStrain00033122 WormBase (WB) WB available WB-STRAIN:RB2447, CGC_RB2447 2026-08-29 09:21:53 0
RB2448
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00033123 Caenorhabditis elegans ZC84.3(ok3375) III. Made_by: OMRF Knockout Group|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"ZC84.3 Homozygous. Outer Left Sequence: cttgggaaaccttgtcgtgt. Outer Right Sequence: caaacatttccctttttggc. Inner Left Sequence: caaagaaagacccgtttcca. Inner Right Sequence: tgcaaatatgttccaatcaataca. Inner Primer PCR Length: 1312. Deletion size: about 400 bp." WBGene00013847(cls-3) WBGene00013847(cls-3) WB-STRAIN:WBStrain00033123 WormBase (WB) WB available WB-STRAIN:RB2448, CGC_RB2448 2026-08-29 09:21:53 0
RB2463
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00033138 Caenorhabditis elegans T25B6.2(ok3402) X. Made_by: OMRF Knockout Group|"T25B6.2 Homozygous. Outer Left Sequence: tgcatggatcttctcactgc. Outer Right Sequence: tctgggtacattgggctacc. Inner Left Sequence: gccatacggaactggatacg. Inner Right Sequence: aacctggttggttctgcatt. Inner Primer PCR Length: 1196. Deletion size: about 1100 bp."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00020788(nep-22) WBGene00020788(nep-22) WB-STRAIN:WBStrain00033138 WormBase (WB) WB available WB-STRAIN:RB2463, CGC_RB2463 2026-08-29 09:21:54 0
RB2464
 
Resource Report
Resource Website
1+ mentions
RRID:WB-STRAIN:WBStrain00033139 Caenorhabditis elegans tax-2(ok3403) I. F36F2.5 Homozygous. Outer Left Sequence: cgccaagaagtgaagattcc. Outer Right Sequence: acgcttgtaatgccgaaagt. Inner Left Sequence: gcaaatgcttcaaaagagcc. Inner Right Sequence: gagtccgagcaattctgaaaa. Inner Primer PCR Length: 1121. Deletion size: about 400 bp.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00006525(tax-2) WBGene00006525(tax-2) WB-STRAIN:WBStrain00033139 WormBase (WB) WB available PMID:38302462 WB-STRAIN:RB2464, CGC_RB2464 2026-08-29 09:21:54 2

Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.